________________________

[Gość: اللאΘ]

دوت كوم, أو العودة إيمكنك حث في أرابسالبتيا حى صفرئيسة تنااضا واعرخدماتنلأגשצט
דםנןק
ז בזונלשצןخرى أي من ا
FUCK ARαBS !!!يسαש
גרFרםןג

[Gość: Maximus]

Treść świadczy o tobie.......

[Gość: yota]

to jakis bezmozgowiec ktory nawet nie wie ze jest na polskim forum...

[Gość: Maximus]

Coraz ich więcej! Tylko jedno mnie ciekawi, skąd oni biorą taką śmieszną
kulfoniastą klawiaturę?

yota czego greka udajesz ?

[Gość: kapa]

ψαπισζονιε !!!!

[Gość: yota]

a ty dlaczego analfabete udajesz ???
jak widac po polsku tez cie nauczyli pisac.

[Gość: μιν]

Gość portalu: Maximus napisał(a):

> Treść świadczy o tobie.......

τυ ηθξθ ξεβανυ !!!!
erudyta?
אט צשלדש או מןק וגש'שח !

[Gość: Maximus]

NIe, erotoman. A jak myślisz Szekspirze?

.do maximusia.

[Gość: .......]

.dpier..l s.e
p. p.lsku n.e r.zum.esz ?

[Gość: Maximus]

Doskonale, a ty chyba masz problemy z dykcją?

[Gość: yota]

mysle, ze ta "mundrala" ma problemy nie tylko z dykcja...
...jak widac z glowka tez cos nie tak...

[Gość: Maximus]

Tak na pewno, poza tym ten kod przydaje mu się do oszukiwania w grze w kapsle.

do analfabety

[Gość: yota]

zabieraj te swoje mazgroly i kulfony i przenies swoje madrosci na
inne forum

d.O bA.r.An.A !!!!

[Gość: גRכובל]

FΩ<Κ ΥΟΘ !!!

[Gość: Maximus]

Widzę stary,że się rozwijasz. Może następnym razem podpiszesz się kodem
kreskowym.

===============================================

[Gość: <>]

ΡΘΓΑΤ ΝΙΕ ΝΑΔΑ
================================
ещдлщ зф кгылш !
א

[Gość: Maksimus]

Widzę, że ciebie też naszło, a kiedy napiszesz nam coś cyrylicą bądź minuskułą
karolińską?

: ===============================================:

[Gość: :=:=:=:]

ЖYΔΘVSKI JEZYK

[Gość: Maximus]

No stary! Ale teraz to mi dogryzłeś, chyba nie będę mógł spać. Bywaj lamerze!!!

(\/\/\/\/\/\/\/\/\/\/) \/*****\/ [______________]

[Gość: 品「。」回]

世同二元 目 目
ロ図 元
日世同 同
目目目匹 同
目目図目匹図 同
目目目目目目目日ロ世

[Gość: (::::::)]

: 品「。図目」回

世 同匹 同
目 目日ロ世
目匹 図 同
二元 目 目
ロ 図 元
日世同 同
目目目 目目目目目目> ;
>

2002 LEARNED ELDERS OF ZION

[datsh]

www.arttherapy.org/

[korporacja]

datsh napisał(a):

www.arttherapy.org
©

yota w yote.... idyota

[alef1]

Gość portalu: yota napisał(a):
zabieraj te swoje mazgroly i kulfony i przenies swoje madrosci na
inne forum....kolego id yoto ja tu pracuje w tej gazecie...

[Gość: Karl]

Całkowicie się zgadzam (przynajmniej z tym co jest po ang.) też bym się
przespał z jakąś seksowną arabką.

..........................................1001 NOC

[Gość: Z[]N]

Gość portalu: Karl napisał(a):
Całkowicie się zgadzam (przynajmniej z tym co jest po ang.) też bym się
przespał z jakąś seksowną arabką.
sprawdz ktora Ci pasuje...pzdr Z[]N
www.1000and1.de/forum/index_e.htm
www.1000and1.de/
www.1000and1.de/forum/index_e.htm
www.1000and1.de/picture/jpg/matahar.jpg
www.1000and1.de/picture/portrait/eshtar2.jpg
www.1000and1.de/picture/portrait/zeynep2.jpg

Lydia Tzigane

Click on Picture for more! Lydia Tzigane lives in Sharjah, a city in the United
Arabic Emirates and performs mostly in Dubai.
Since 1984 she has espoused the oriental dance and has shown her knowledge of art
already in many of the large hotels of the middle east.
A long time she has a dream, to become a dancer, if she has thought also
initially sooner about a career in the ballet. Then however she got to know the
oriental culture and and she love it. So she began to learn the oriental dance.
The feeling for this dance has gotten put Lydia well about her Origin, she is an
Romanov Gipsy.
She began her dance-career in Egypt and the persons there pleased here dancestyle
and work so well, that she was booked more and more for appearances, and from
there she got more and more bookings and contracts.
There followed firm engagements in many important hotels of the middle east.
Lydia Tzigane has found her own style.

She says over herself:
"I love it because it is a free form of dancing ,there are some rules and
basics ,but every dancer can put her own soul and fire in it,to make it special
for her and her liking,that is why i like it you can grow and learn every day in
this dancing,put more wood on the fire and the flames becomes bigger. It never
stops, it is a beautiful artform, and fills your soul."
"Tahaya Karyoka,told me when i met her in Egypt,to stay as i was ,not to copy any
other dancer and to became my own identety, so people would remember me,with my
own style,that is what i never forgot,and it worked!! people always tell me --you
are different

..................................................

[Gość: ........]

www.kontaktnatet.se/forum.asp

.....................arabska propaganda

[Gość: פ-ש-מ]

PA Editorial: Jews are Tatars, Mongolians, Nazis and WASPs
by
April 12, 2002

Combining gutter anti-Semitism, implied denial of the Holocaust, innuendo and
wild exaggeration, a recent Palestinian Authority editorial accused the Jews of
having “brought back the Tatar, the Mongolians, the Nazis and all the invaders
throughout the dark history of mankind… they are the descendants of Hulagu
[grandson of Genghis Khan – NR] and Hitler…” The PA news agency, WAFA, also had
something to say to “the Americans and to the British, who are the admirers of
our holocaust and ongoing disasters…”

“The Israelis, backed by the USA are attacking the Palestinians, then Iraq,
then Lebanon and then the other Arab countries,” wrote the WAFA
editor, “because the accusations are ready: ‘Terror.’ The courts are
ready: ‘Israel and the USA.’ The executioners are ready, also: ‘Israel the USA’
and maybe others.”

“[I]n the past of the dark days of the ‘WASP’,” the WAFA news agency editorial
pointed out, “with which [sic] the white man massacred, erasing one hundred and
twelve million Native Americans…” there was no media to capture the events. The
same was true, according to the PA press agency, “when Hitler sent Jews, of
disputed numbers, among the Jews themselves, to the gas chambers and much,
much, more of other Europeans and Soviets.” Therefore, according to the
editorial, the historical events “stayed somehow mysterious and in the hands of
those who wanted to change the history according to their desires, or re-write
the history according to their interests.” However, today, “everything is clear
and documented through cameras, media teams and sophisticated equipment…”

Israeli soldiers, the PA editorial claimed, have been “using their police
canines storming, destroying and crashing everything, regardless the patients
or their agony of disease and injury… chasing the wounded in order to make sure
that they will die. The Execution Squad is another Israeli treat.” However, the
article actually contradicts the fallacy that the PLO opposes only
the ‘settlers and soldiers’, when it said of them, “They seemed to have emerged
from the depth of the dark and evil history of their ancestors.” The editorial
of the official PA news agency clarified exactly what it meant by that,
saying, “Joy to the Jews, who are proud of their army, which horribly kills
gentiles… And the Jewish ‘Talmud’ orders them to leave the gentiles bleeding to
death as long as the victim is a gentile, and that is exactly what is taking
place in Ramallah. They are implementing all the ‘Torah’ that they have
received from their Rabbis…” The editorialist assured his readers, “This is not
a fantasy vision, it is real…”

The colorful European medieval imagery and lies used in the PA editorial
regarding the Jews also dictated that an appropriate martyr image be used for
the besieged PLO leader. Apparently, the author thought that the image of Jesus
would serve his purposes well. He wrote, Arafat “is like the Nazarene, that
sacrifices himself for the Palestinians and the whole nation.”

ISRAELI VICTIMS OF TERROR SINCE SEPT 2000

[Gość: :▄▄▄▄:]

http://www.walk4israel.com/index.cfm?fuseaction=Mitzvah

ISRAELI VICTIMS OF TERROR SINCE SEPT 2000

LIST OF NAMES BY DATE

Sept 27, 2000 - Sgt. David Biri, 19, of Jerusalem, was fatally wounded in a
bombing near Netzarim in the Gaza Strip.

Sept 29, 2000 - Border Police Supt. Yossi Tabaja, 27, of Ramle was shot to
death by his Palestinian counterpart on a joint patrol near Kalkilya.

Oct 1, 2000 - Border Police Cpl. Yosef Madhat, 19, of Beit Jann, died of
gunshot wounds sustained in a gun battle with Palestinians at Joseph's Tomb in
Nablus.

Oct 2, 2000 - Wichlav Zalsevsky, 24, of Ashdod, was shot in the head in the
village of Masha on the trans-Samaria highway.
Sgt. Max Hazan, 20, of Dimona, died of gunshot injuries sustained near Beit
Sahur.

Oct 8, 2000 - The bullet-riddled body of Hillel Lieberman, 36, of Elon Moreh
was found at the southern entrance to Nablus.

Oct 12, 2000 - First Cpl. Yosef Avrahami and First Sgt. Vadim Novesche, 33, two
reserve IDF soldiers, were lynched by a Palestinian mob at the police building
in Ramallah.

Oct 19, 2000 - Rabbi Binyamin Herling, 64, of Kedumim, was killed when Fatah
members and Palestinian security forces opened fire on a group of Israeli men,
women, and children on a trip at Mount Ebal near Nablus.

Oct 28, 2000 - The body of Marik Gavrilov, 25, of Bnei Aysh was found inside
his burned-out car, between the village of Bitunia and Ramallah.

Oct 30, 2000 - Eish-Kodesh Gilmor, 25, of Mevo Modi'in, was shot and killed
while on duty as a security guard at the National Insurance Institute's East
Jerusalem branch. Another guard was injured.
Amos Machlouf, 30, of the Gilo neighborhood in Jerusalem, was found murdered in
a ravine near Beit Jala.

Nov 1, 2000 - Lt. David-Hen Cohen, 21, of Karmiel and Sgt. Shlomo Adshina, 20,
of Kibbutz Ze'elim were killed in a shooting incident in the Al-Hader area,
near Bethlehem.

Nov 1, 2000 - Maj. (res.) Amir Zohar, 34, of Jerusalem was killed in the Nahal
Elisha settlement in the Jordan Valley while on active reserve duty.

Nov 2, 2000 - Ayelet Shahar Levy, 28, and Hanan Levy, 33, were killed in a car
bomb explosion near the Mahane Yehuda market in Jerusalem. 10 people were
injured in the blast. The Islamic Jihad claimed responsibility for the attack.

Nov 8, 2000 - Noa Dahan, 25, of Moshav Mivtahim in the south, was shot to death
while driving to her job at the Rafah border crossing in Gaza.

Nov 10, 2000 - Sgt. Shahar Vekret, 20, of Lod was fatally shot by a Palestinian
sniper near Rachel's Tomb at the entrance to Bethlehem.

Nov 11, 2000 - Sgt. 1st Class Avner Shalom, 28, of Eilat, was killed in a
shooting attack at the Gush Katif junction in the Gaza Strip.

Nov 13, 2000 - Sarah Leisha, 42, of Neveh Tzuf was killed by gunfire from a
passing car while travelling near Ofra, north of Ramallah.
Cpl. Elad Wallenstein, 18, of Ashkelon, and Cpl. Amit Zanna, 19, of Netanya
were killed by gunfire from a car passing the military bus carrying them near
Ofra.

Nov 13, 2000 - Gabi Zaghouri, 36, of Netivot was killed by gunfire directed at
the truck he was driving near the Kissufim junction in the southern part of the
Gaza Strip.

Nov 18, 2000 - St.-Sgt. Baruch (Snir) Flum, 21, of Tel-Aviv was shot and killed
by a senior Palestinian Preventive Security Service officer who infiltrated the
Kfar Darom greenhouses in the Gaza Strip.
St.-Sgt. Sharon Shitoubi, 21, of Ramle, wounded in the Palestinan shooting
attack in Kfar Darom, died of his wounds on Nov 20.

Nov 20, 2000 - Miriam Amitai, 35, and Gavriel Biton, 34, both of Kfar Darom,
were killed when a roadside bomb exploded alongside a bus carrying children
from Kfar Darom to school in Gush Katif. Nine others, including 5 children,
were injured.

Nov 21, 2000 - Itamar Yefet, 18, of Netzer Hazani died from a gunshot wound to
the head by Palestinian sniper fire at the Gush Katif junction.

Nov 22, 2000 - Shoshana Reis, 21, of Hadera, and Meir Bahrame, 35, of Givat
Olga, were killed, and 60 wounded when a powerful car bomb was denotated
alongside a passing bus on Hadera's main street, when the area was packed with
shoppers and people driving home from work. 60 were wounded in the blast.

Nov 23, 2000 - Lt. Edward Matchnik, 21, of Beersheba, was killed in an
explosion at the District Coordination Office near Gush Katif in the Gaza
Strip. (The joint DCOs were established at the borders of Palestinian-ruled
areas under the interim peace accords and were responsible for coordinating
security and humanitarian cooperation.)

Nov 23, 2000 - Sgt. Samar Hussein, 19, of Hurfeish, was killed when Palestinian
snipers opened fire at soldiers patrolling the border fence near the Erez
crossing.

Nov 24, 2000 - Maj. Sharon Arameh, 25, of Ashkelon was killed by Palestinian
sniper fire in fighting near Neve Dekalim in the Gaza Strip.

Nov 24, 2000 - Ariel Jeraffi, 40, of Petah Tikva, a civilian employed by the
IDF, was killed by Palestinian fire as he travelled near Otzarin in the West
Bank.

Dec 8, 2000 - Rina Didovsky, 39, a Beit Hagai school teacher on her way to
work, and Eliyahu Ben-Ami, 41, of Otniel, the driver of the van, were killed
when a car full of gunmen opened fire on the van near Kiryat Arba.

Dec 8, 2000 - Sgt. Tal Gordon, 19, was killed when gunmen in a passing car
opened fire on an Egged bus traveling south from Tiberias to Jerusalem on the
Jericho bypass road.

Dec 21, 2000 - Eliahu Cohen, 29, of Modi'in was shot and killed tonight by
Palestinian terrorists waiting in ambush on the road between Givat Ze'ev and
Beit Horon.

Dec 28, 2000 - Capt. Gad Marasha, 30, of Kiryat Arba and Border Police Sgt.-
Maj. Yonatan Vermullen, 29, of Ben-Shemen, were killed when called to dismantle
a road-side bomb near the Sufa crossing in the Gaza Strip. The bomb was
dismantled, but another bomb exploded, killing both and injuring two other
soldiers. The Islamic Jihad claimed responsibility for the attack.

Dec 31, 2000 - Binyamin Zeev Kahane, the son of the late right-wing leader Meir
Kahane, and his wife, Talia, were killed when Palestinian snipers opened fire
while they were driving on the Ramallah bypass road. Five of their children,
aged two months to 10 years, were injured.

Jan 14, 2001 - The bullet-ridden body of Ron Tzalah, 32, of Kfar Yam in Gush
Katif, apparently killed on Sunday night (Jan 14), was found the following
morning near the Kfar Yam hothouses.

Jan 17, 2001 - Ofir Rahum, 16, of Ashkelon, traveled to Jerusalem to meet a
young woman with whom he had conducted a relationship over the Internet. She
then drove him toward Ramallah. At a prearranged location, another vehicle
drove up and three Palestinian gunmen inside shot Rahum more than 15 times. One
terrorist drove off with Rahum's body and dumped it, while the others fled in
the second vehicle.

Jan 23, 2001 - Motti Dayan, 27, and Etgar Zeituny, 34, cousins from Tel Aviv,
were abducted from a restaurant in Tulkarem by masked Palestinian gunmen and
executed.

Jan 25, 2001 - Akiva Pashkos, 45, of Jerusalem, was shot dead in a terror
attack near the Atarot industrial zone north of Jerusalem.

Jan 29, 2001 - Arye Hershkowitz, 55, of Ofra, was killed by shots fired from a
passing car near the Rama junction north of Jerusalem.

Feb 1, 2001 - Dr. Shmuel Gillis, 42, of Karmei Tzur, was killed by Palestinian
gunmen who fired at his car near the Aroub refugee camp on the Jerusalem-Hebron
highway.

Feb 1, 2001 - Lior Attiah, 23, of Afula was shot to death by terrorists while
traveling near Jenin.

Feb 5, 2001 - St.-Sgt. Rujayah Salameh, 23, was killed by sniper fire near
Rafah.

Feb 11, 2001 - Tzachi Sasson, 35, of Kibbutz Rosh Tzurim in Gush Etzion, was
shot and killed by Palestinian gunmen as he drove home from Jerusalem.

2...ISRAELI VICTIMS OF TERROR SINCE SEPT 2000

[Gość: :▄▄▄▄:]

www.walk4israel.com/index.cfm?fuseaction=Mitzvah

Feb 11, 2001 - Tzachi Sasson, 35, of Kibbutz Rosh Tzurim in Gush Etzion, was
shot and killed by Palestinian gunmen as he drove home from Jerusalem.

Feb 14, 2001 - Simcha Shitrit, 30, of Rishon Lezion; Staff-Sgt. Ofir Magidish,
20, of Kiryat Malachi; Sgt. David Iluz, 21, of Kiryat Malachi; Sgt. Julie
Weiner, 21, of Jerusalem; Sgt. Rachel Levi, 19, of Ashkelon; Sgt. Kochava
Polanski, 19, of Ashkelon; Cpl. Alexander Manevich, 18, of Ashkelon; and Cpl.
Yasmin Karisi, 18, of Ashkelon were killed when a bus driven by a Palestinian
terrorist plowed into a group of soldiers and civilians waiting at a bus stop
near Holon, south of Tel-Aviv. In addition, 25 people were injured in the
attack.

Feb 26, 2001 - The body of Mordechai Shefer, 55, of Kfar Sava, was found in an
olive grove near Moshav Hagor. An autopsy revealed that he was murdered.
Investigators suspect terrorist motives.

Mar 1, 2001 - Claude Knap, 29, of Tiberias was killed and 9 people injured when
a terrorist detonated a bomb in a Tel Aviv to Tiberias service taxi at the Mei
Ami junction in Wadi Ara.

Mar 4, 2001 - Naftali Dean, 85, of Tel Mond; his niece, Shlomit Ziv, 58, of
Netanya; and Yevgenya Malchin, 70, of Netanya were killed in a suicide bombing
in downtown Netanya; 60 people were injured. The Hamas claimed responsibility
for the attack.

Mar 19, 2001 - Baruch Cohen, 59, of Efrat, was killed by shots fired at his car
while driving to work in Jerusalem from his home in the Gush Etzion area. After
being hit by bullets, he lost control of the car and collided with an oncoming
truck.

Mar 26, 2001 - Shalhevet Pass, age 10 months, was killed by sniper fire at the
entrance to the Avraham Avinu neighborhood in Hebron.

Mar 28, 2001 - Eliran Rosenberg-Zayat, 15, of Givat Shmuel and Naftali
Lanzkorn, 13, of Petah Tikva were killed in a suicide bombing at the Mifgash
Hashalom ("peace stop") gas station several hundred meters from an IDF
roadblock near the entrance to Kalkilya, east of Kfar Saba. Four people were
injured. Hamas claimed responsibility for the attack.

Apr 1, 2001 - Staff Sgt. Ya'akov Krenschel, 23, of Nahariya, an IDF reserve
soldier, was killed in a firefight between army and Palestinian forces
southeast of Nablus.

Apr 1, 2001 - Dina Guetta, 42, of Haifa, was stabbed to death on Ha'atzmaut
Street. Her murder was the initiation rite into a terrorist cell apprehended in
July.

Apr 2, 2001 - Sgt. Danny Darai, 20, of Arad, was killed by a Palestinian sniper
after completing guard duty at Rachel's Tomb at the entrance to Bethlehem.

Apr 21, 2001 - The mutilated body of Stanislav Sandomirsky, 38, of Beit
Shemesh, was found in the trunk of his car near a village north of Ramallah
late last night. Terrorist motives are suspected.

Apr 22, 2001 - Dr. Mario Goldin, 53, of Kfar Sava, was killed when a terrorist
detonated a powerful bomb he was carrying near a group of people waiting at a
bus stop on the corner of Weizman and Tchernichovsky streets. About 60 people
were injured in the blast. Hamas claimed responsibility.

Apr 28, 2001 - Sgt. Shlomo Elmakias, 20, of Netanya, was killed and four women
passengers wounded in a drive-by terrorist shooting attack on the Wadi Ara
highway in the Galilee.

Apr 28, 2001 - Simcha Ron, 60, of Nahariya, was found stabbed to death in Kfar
Ba'aneh, near Carmiel in the Galilee. The terrorists responsible for the attack
were apprehended in July.

May 1, 2001 - Assaf Hershkowitz, 30, of Ofra, was killed when his vehicle was
fired upon and overturned at a junction between Ofra and Beit El.

May 8, 2001 - Arnaldo Agranionic, 48, was murdered by terrorists as he guarded
the Binyamin Farm, a lonely outpost where he lived, on an isolated hilltop east
of Itamar in Samaria.

May 9, 2001 - Yossi Ish-Ran, 14, and Kobi Mandell, 14, both of Tekoa, were
found stoned to death in a cave about 200 meters from the small community south
of Jerusalem where they lived.

May 10, 2001 - Constantin Straturula, 52, and Virgil Martinesc, 29, two
Romanian citizens employed by an Israeli contractor, were killed in a bomb
attack while repairing a vandalized fence at the Kissufim Crossing into the
Gaza District.

May 15, 2001 - Idit Mizrahi, 20, of Rimonim, was fatally shot in a terrorist
ambush as she drove with her father and brother on the Alon Highway to attend a
family wedding. Terrorists fired 30 bullets, 19 of which hit the family's car.

May 18, 2001 - Tirza Polonsky, 66, of Moshav Kfar Haim; Miriam Waxman, 51, of
Hadera; David Yarkoni, 53, of Netanya; Yulia Tratiakova, 21, of Netanya; and
Vladislav Sorokin, 34, of Netanya were killed in a suicide bombing at Hasharon
Mall in the seaside city of Netanya, in which over 100 were wounded. Hamas
claimed responsibility for the attack.

May 18, 2001 - Lt. Yair Nebenzahl, 22, of Neve Tzuf (Halamish), was killed and
his mother seriously wounded, in a Palestinian roadside ambush north of
Jerusalem.

May 23, 2001 - Asher Iluz, 33, of Modi'in was killed outside Ariel en route to
supervise a road paving in the area, when Palestinian gunmen opened fire in an
ambush.

May 25, 2001 - The burnt body of Yosef Alfasi, 50, of Rishon Letzion, was
discovered near the West Bank city of Tulkarem.

May 29, 2001 - Gilad Zar, 41, of Itamar, was shot dead in a terrorist ambush
while driving in the West Bank between Kedumim and Yizhar. The Fatah Tanzim
claimed responsibility for the attack.

May 29, 2001 - Sarah Blaustein, 53, and Esther Alvan, 20, of Efrat, were killed
in a drive-by shooting near Neve Daniel in the Gush Etzion bloc south of
Jerusalem. The Fatah Tanzim claimed responsibility for the attack.

May 31, 2001 - Zvi Shelef, 63, of Mevo Dotan, was killed in a drive-by shooting
attack in northern Samaria north of Tulkarem. He was shot in the head and died
en route to hospital.

June 1, 2001 - Marina Berkovizki, 17, of Tel Aviv; Roman Dezanshvili, 21, of
Bat Yam; Ilya Gutman, 19, of Bat Yam; Anya Kazachkov, 16, of Holon; Katherine
Kastaniyada-Talkir, 15, of Ramat Gan; Aleksei Lupalu, 16, of the Ukraine;
Mariana Medvedenko, 16, of Tel Aviv; Irina Nepomneschi, 16, of Bat Yam; Yelena
Nelimov, 18, of Tel Aviv; Yulia Nelimov, 16, of Tel Aviv; Raisa Nimrovsky, 15,
of Netanya; Pvt. Diez (Dani) Normanov, 21, of Tel Aviv; Simona Rodin, 18, of
Holon; Ori Shahar, 32, of Ramat Gan; Liana Sakiyan, 16, of Tel Aviv; Maria
Tagilchev, 14, of Netanya; and Irena Usdachi, 18, of Holon were killed when a
suicide bomber blew himself outside a disco near Tel Aviv's Dolphinarium along
the seafront promenade just before midnight on Friday. Sergei Pancheskov, 20,
of the Ukraine; Yael-Yulia Sklianik, 15, of Holon; Jan Bloom, 25, of Ramat Gan;
and Yevgenia Dorfman, 15, of Bat Yam died subsequently from their injuries. 120
people were wounded in the bombing.

June 11, 2001 - Yehuda Shoham, aged 5 months, of Shilo, died of injuries
incurred in a fatal stoning on June 5. He was critically injured by a rock
thrown at the family's car near Shilo in Samaria.

June 12, 2001 - Father Georgios Tsibouktzakis, 34, a Greek Orthodox monk from
the St. George Monastery in Wadi Kelt in the Judean desert, was shot and killed
while driving on the Jerusalem-Ma'ale Adumim road.

June 14, 2001 - Lt.Col. Yehuda Edri, 45, of Ma'ale Adumim was killed by a
Palestinian informant for Israeli intelligence in a shooting attack on the
Bethlehem bypass tunnel road connecting the Gush Etzion bloc with Jerusalem.
One of his security guards was seriously injured.

June 18, 2001 - Dan Yehuda, 35, of Homesh was killed in a drive-by shooting
attack between Homesh and Shavei Shomron, near Nablus. Alex Briskin, 17, was
moderately injured.

Feb 1, 2001 - Doron Zisserman, 38, of Einav, was shot and killed in

: 3....ISRAELI VICTIMS OF TERROR SINCE SEPT 2000

[Gość: :▄▄▄▄:]

http://www.walk4israel.com/index.cfm?

Feb 18, 2002 - Policeman Ahmed Mazarib, 32, of the Bedouin village Beit Zarzir
in the Galilee, was killed by a suicide bomber whom he had stopped for
questioning on the Ma'ale Adumim-Jerusalem road. The terrorist succeeded in
detonating the bomb in his car. The Fatah al-Aqsa Martyrs Brigades claimed
responsibility for the attack.

Feb 18, 2002 - Ahuva Amergi, 30, of Ganei Tal in Gush Katif was killed and a 60-
year old man was injured when a Palestinian terrorist opened fire on her car.
Maj. Mor Elraz, 25, of Kiryat Ata and St.-Sgt. Amir Mansouri, 21, of Kiryat
Arba, who came to their assistance, were killed while trying to intercept the
terrorist. The terrorist was killed when the explosives he was carrying were
detonated. The Fatah al-Aqsa Martyrs Brigades claimed responsibility for the
attack.

Feb 19, 2002 - Lt. Moshe Eini, 21, of Petah Tikva; St.-Sgt. Benny Kikis, 20, of
Carmiel; St.-Sgt. Mark Podolsky, 20, of Tel Aviv; St.-Sgt. Erez Turgeman, 20,
of Jerusalem; St.-Sgt. Tamir Atsmi, 21, of Kiryat Ono; and St.-Sgt. Michael
Oxsman, 21, of Haifa were killed and one wounded in an attack near a roadblock
west of Ramallah. Several terrorists opened fire at soldiers at the roadblock,
including three off-duty soldiers inside a structure at the roadblock, killing
them at point-blank range. The Fatah al-Aqsa Martyrs Brigades claimed
responsibility for the attack.

Feb 22, 2002 - Valery Ahmir, 59, of Beit Shemesh was killed by terrorists in a
drive-by shooting on the Atarot-Givat Ze'ev road north of Jerusalem as he
returned home from work. Fatah claimed responsibility for the attack.

Feb 25, 2002 - Avraham Fish, 65, and Aharon Gorov, 46, both of Nokdim, were
killed in a terrorist shooting attack between Tekoa and Nokdim, south of
Bethlehem. Fish's daughter, 9 months pregnant, was seriously injured but
delivered a baby girl. The Fatah al-Aksa Brigades claimed responsibility for
the attack.

Feb 25, 2002 - Police officer 1st Sgt. Galit Arbiv, 21, of Nesher, died after
being fatally shot, when a terrorist opened fire at a bus stop in the Neve
Ya'akov residential neighbhorhood in northern Jerusalem. Eight others were
injured, two seriously. The Fatah al-Aksa Brigades claimed responsibility for
the attack.

Feb 27, 2002 - Gad Rejwan, 34, of Jerusalem, was shot and killed early
Wednesday morning by one of his Palestinian employees in a factory in the
Atarot industrial area, north of Jerusalem. Two Fatah groups issued a joint
statement taking responsibility for the murder.

Feb 28, 2002 - IDF soldier St.-Sgt. Haim Bachar, 20, of Tel Aviv was killed
during clashes with Palestinians in the Balata refugee camp near Nablus. IDF
forces entered the camp to search for wanted terrorists.

Mar 1, 2002 - IDF soldier Sgt. Ya'acov Avni, 20, of Kiryat Ata was killed by
Palestinian sniper fire in the Jenin refugee camp.

Mar 2, 2002 - The bullet-ridden body of Jerusalem police detective Chief-Supt.
Moshe Dayan, 46, of Ma'aleh Adumim, was discovered next to his trail
motorcycle, near the Mar Saba Monastery in the Judean Desert. Tanzim claimed
responsibility for the attack.

Mar 2, 2002 - Ten people were killed and over 50 were injured, 4 critically, in
a suicide bombing at 19:15 on Saturday evening near a yeshiva in the ultra-
Orthodox Beit Yisrael neighborhood in the center of Jerusalem where people had
gathered for a bar-mitzva celebration. The terrorist detonated the bomb next to
a group of women waiting with their baby carriages for their husbands to leave
the nearby synagogue. The victims: Shlomo Nehmad (40), his wife Gafnit (32),
and their daughters Shiraz (7) and Liran (3), of Rishon Lezion; Shaul Nehmad
(15), of Rishon Lezion; Lidor Ilan (12) and his sister Oriah (18 months), of
Rishon Lezion; Tzofia Ya'arit Eliyahu (23) and her son Ya'akov Avraham (7
months), of Jerusalem. Avi Hazan, 37, of Moshav Adora, died of his injuries on
Monday morning (Mar 4). The Fatah Al-Aqsa Martyrs Brigade took responsibility
for the attack.

Mar 3, 2002 - Ten Israelis - 7 soldiers and 3 civilians - were killed and 6
injured when a terrorist opened fire at an IDF roadblock near Ofra in Samaria:
Capt. Ariel Hovav, 25, of Eli; Lt.(res.) David Damelin, 29, of Kibbutz Metzar;
1st Sgt.(res.) Rafael Levy, 42, of Rishon Lezion; Sgt.-Maj.(res.) Avraham Ezra,
38, of Kiryat Bialik; Sgt.-Maj.(res.) Eran Gad, 24, of Rishon Letzion; Sgt.-Maj.
(res.) Yochai Porat, 26, of Kfar Sava; Sgt.-Maj.(res.) Kfir Weiss, 24, of Beit
Shemesh; Sergei Butarov, 33, of Ariel; Vadim Balagula, 32, of Ariel; and Didi
Yitzhak, 66, of Eli. The Fatah Al-Aqsa Martyrs Brigade claimed responsibility
for the attack.

Mar 3, 2002 - Sgt. Steven Koenigsburg, 19, of Hod Hasharon was killed and 4
soldiers injured when a Palestinian gunman opened fire near the Kissufim
crossing in the Gaza Strip. The Islamic Jihad and Tanzim claimed responsibility
for the attack.

Mar 5, 2002 - Police officer FSM Salim Barakat, 33, of Yarka; Yosef Habi, 52,
of Herzliya; and Eli Dahan, 53, of Lod were killed and over 30 people were
wounded in Tel-Aviv when a Palestinian terrorist opened fire on two adjacent
restaurants shortly after 2:00 AM. The Fatah Al-Aqsa Martyrs Brigade claimed
responsibility for the attack.

Mar 5, 2002 - Devorah Friedman, 45, of Efrat, was killed and her husband
injured in shooting attack on the Bethlehem bypass "tunnel road", south of
Jerusalem. The Fatah Al-Aqsa Martyrs Brigade claimed responsibility for the
attack.

Mar 5, 2002 - Maharatu Tagana, 85, of Upper Nazareth was killed and a large
number of people injured, most lightly, when a suicide bomber exploded in an
Egged No. 823 bus as it entered the Afula central bus station. The Islamic
Jihad claimed responsibility for the attack.

Mar 6, 2002 - 1st Lt. Pinhas Cohen, 23, of Jerusalem, was killed overnight near
the southern Gaza town of Khan Yunis, in the course of anti-terrorist activity.
Cpl.(res.) Alexander Nastarenko, 37, of Netanya was killed when Palestinian
gunmen crossed the border fence and ambushed an army jeep on the patrol road
near Kibbutz Nir Oz.

Mar 7, 2002 - Arik Krogliak of Beit El, Tal Kurtzweil of Bnei Brak, Asher
Marcus of Jerusalem, Eran Picard of Jerusalem, and Ariel Zana of Jerusalem, all
aged 18, were killed and 23 people were injured, four seriously, when a
Palestinian gunman penetrated the pre-military training academy in the Gush
Katif settlement of Atzmona. Hamas claimed responsibility for the attack.

Mar 8, 2002 - St.-Sgt. Edward Korol, 20, of Ashdod, was killed by a Palestinian
sniper in Tulkarem.

Mar 9, 2002 - Avia Malka, 9 months, of South Africa, and Israel Yihye, 27, of
Bnei Brak were killed and about 50 people were injured, several seriously, when
two Palestinians opened fire and threw grenades at cars and pedestrians in the
coastal city of Netanya on Saturday evening, close to the city's boardwalk and
hotels. The terrorists were killed by Israeli border police. The Fatah Al Aqsa
Brigades claimed responsibility for the attack.

Mar 9, 2002 - Limor Ben-Shoham, 27, of Jerusalem; Nir Borochov, 22, of Givat
Ze'ev; Danit Dagan, 25, of Tel-Aviv; Livnat Dvash, 28, of Jerusalem; Tali
Eliyahu, 26, of Jerusalem; Uri Felix, 25, of Givat Ze'ev; Dan Imani, 23, of
Jerusalem; Natanel Kochavi, 31, of Kiryat Ata; Baruch Lerner, 29, of Eli; Orit
Ozerov, 28, of Jerusalem; Avraham Haim Rahamim, 28, of Jerusalem were killed
and 54 injured, 10 of them seriously, when a suicide bomber exploded at 22:30
PM Saturday night in a crowded cafe at the corner of Aza and Ben-Maimon streets
in the Rehavia neighborhood in the center of Jerusalem. Hamas claimed
responsibility for the attack.

Mar 10, 2002 - St.-Sgt. Kobi Eichelboim, 21, of Givatayim died Sunday afternoon
from wounds suffered

RUBRYKI

[Gość: {{{:}}}]

www.debka.com/
HEADLINES

Hizballah Launches Anti-Air Barrage Wednesday
Against Israel’s Western Galilee
Saudis Claim Israeli Warplanes Fly over
Jordanian-Saudi Frontier, Order Air Defenses to
Shoot Down Alien Overflights
Earlier, Saudis and Israelis Denied Concentrating
Troops on Respective Jordanian Frontiers
Read DEBKAfile Special Military Analysis of
Latest Military Movements in Region
Three Palestinians Die in Explosion Wednesday at Gaza’s Jebalyah Camp
Obstacle in Bethlehem Church of Nativity Negotiations
DEBKAfile’s Sources:
Arafat Backs Down from Undertaking to US Envoy Burns
For Armed Palestinians in Church to Be Deported to Gaza
Israel Suspends Acceptance of UN Fact-Finding
Team for Jenin, Finding it Political,
Unqualified to Judge Military Situation
Federal German Police Arrest 11 Members of London-Based Palestinian Islamic “al-
Tawhid” Group Monday to Foil Attacks on Jewish and Israeli Targets
Israeli Troops Kill Three Palestinians Attempting to
Raid Gaza Strip’s Netsarim
Large UK Rally Demonstrating Solidarity with Israel, Protesting Anti-Semitism
Scheduled for May 6 in Trafalgar Square

A Short Explanation of the Jewish Calendar

[datsh]

Two for the Price of One
A Short Explanation of the Jewish Calendar
By: Robin Treistman

www.wzo.org.il/en/resources/view.asp?id=149

The names of the Jewish months are actually Babylonian and were brought back to
Israel by Ezra and Nehemia after the Babylonian Exile. Until the naming of the
Jewish months, they were simply known as the "first month", the "second month",
and so on, starting their counting with the month of Nissan (when Passover
falls out) and NOT with Tishrei (Rosh Hashana). So Rosh Hashana actually
happens in the seventh month.

When looking at the calendar from a Jewish point of view, every day is actually
2 dates. In your mind, the current date may be January 8th 1997, but it is also
the 29th day of the month of Tevet, 5757. This fact may not play a major role
in your life, but it does come in handy when calculating the date of the next
Jewish holiday or the date of someone’s "yahrzeit" (anniversary of death). An
in-depth analysis of the Jewish calendar is a fascinating endeavor which we
won’t do now. However, for a short explanation of the various elements, see
below.

The Gregorian Calendar is solar-based, relying on the fact that every year, the
earth completes one revolution around the sun after 365.25 days. The Jewish
calendar is lunar: The months begin with the advent of the new moon; the full
moon marks the middle of the month, and the month comes to a close when the
moon is once again a tiny sliver. There are 12 months, each lasting 29 or 30
days.

When you add it all up, it comes to a yearly calendar consisting of 354 days.
That is quite a discrepancy from the solar 365.25 days. With this calculation,
you should figure that in about 6 years, Passover, the "Holiday of Spring" will
be celebrated in the dead of winter. But that never happens because the Jewish
calendar has a built-in safety-valve in the form of the leap year. During a
leap year, (which happens 7 times over a 19-year cycle), an extra month (a
second month of Adar) is added so that the Jewish calendar is re-aligned with
the solar seasons. Passover must remain in the springtime, Shavuot in the
summer, Sukkot in early fall, Tu Bishvat in late winter. The added month
insures that arrangement.

I mentioned the 19-year cycle. This pre-calculated cycle was actually developed
by Hillel II in the year 359 CE. The rule follows that a Jewish date and a
Gregorian date will most likely coincide every 19 years (though they can
overlap at other times during the cycle too, and they can also miss because of
the Gregorian leap year). This means that if you were born on the twenty-second
day of Elul or September 6, 1977, then in 1996, your 2 birthdays will once
again (most likely) be on the same day. Note that in the year 1997, your Hebrew
birthday will fall on the 24th of September.

The names of the Jewish months are actually Babylonian and were brought back to
Israel by Ezra and Nehemia after the Babylonian Exile. Until the naming of the
Jewish months, they were simply known as the "first month", the "second month",
and so on, starting their counting with the month of Nissan (when Passover
falls out) and NOT with Tishrei (Rosh Hashana). So Rosh Hashana actually
happens in the seventh month.

One more interesting tidbit: Did you ever wonder why to determine your zodiac
sign, you need to figure from the 19th to the 24th depending on the given
month? Even if you didn't wonder, wouldn't it be interesting to know that the
signs of the Zodiac are actually based on the Jewish (lunar) calendar
corresponding to the Jewish months. For example, Tishrei, the month of Rosh
Hashana and Yom Kippur, is signified by none other than a scale, "Libra." How
and why the signs relate to the specific months are based on intriguing
talmudic, midrashic, and mystical explications.

Maybe this chart will help allay some confusion:

Name of month Month Number When it usually falls Zodiac sign
Tishrei Seventh September-October Libra
Heshvan Eighth October-November Scorpio
Kislev Ninth November-December Sagittarius
Tevet Tenth December-January Capricorn
Shevat Eleventh January-February Aquarius
Adar (plus sometimes Adar 2) Twelfth (and Thirteenth) February-March (and
sometimes April too) Pisces
Nissan First March-April Aries
Iyar Second April-May Taurus
Sivan Third May-June Gemini
Tamuz Fourth June-July Cancer
Av Fifth July-August Leo
Elul Fourth August-September Virgo

One more thing: The Jewish year is also different. When we say that the year is
5757, that means 5757 years from the birth of Adam (you know, the first guy in
the Bible) on the 6th day (or era) of Creation. To give you a bit of
perspective of where in time we are, it is believed that Abraham was born in
the year 1948 of the Jewish calendar; the Exodus was 2448, the modern state of
Israel established in 5708 (1948 CE).

..........................................Rok 5762

[zupagrzybowa]

One more thing: The Jewish year is also different. When we say that the year
is
5757, that means 5757 years from the birth of Adam (you know, the first guy in
the Bible) on the 6th day (or era) of Creation. To give you a bit of
perspective of where in time we are, it is believed that Abraham was born in
the year 1948 of the Jewish calendar; the Exodus was 2448, the modern state of
Israel established in 5708 (1948 CE).

________________________

[alef1]

دوت كوم, أو العودة
إيمكنك حث في
أرابسالبتيا حى
صفرئيسة تنااضا
واعرخدماتنلأגשצט
דםנןק
ז בזונלשצןخرى أي من ا
szalom!!!يسαש
גרFרםןג

¥¥¥¥¥¥¥¥¥¥¥¥¥¥

[Gość: ²©­®¥©¸¯]

³¥¬µ¬°²©­®¥©¸¯³·¨±µ¦¯ºª¶µ¥±µ¦´¶§µ¸©·º«¹¼ª´¸¦°¾©¶À«¸¾§»¹¢¶¸¡º»¤½·¥½º¨À¹©ÁºªÂ¶­¿¶­
¿¶ª¾³§»·¤¾¸¥¿¼¤Á¼¤Á¼¥¾º£¼½¥»¾¦¼½§¸¼¦·¸¤³¼¨·¸ª¶·©µµ©µ´¨´µ¨¸¸«»¶¦¹¶¦¹¸¦¹¸¦¹¾©½¼§»
¼¥¾»¤½¿¨Á¾§À¿¥º²˜­½£¸¾¤¹¹¤¸¹¤¸¹¤¸º¥¹¹¢»¸¡º·£»º¦¾·§ººª½¸¨»·§º»¤½»¤½¼¤¿»£¾·£Â·£Â´¢
Á² ¿³¡À´¢Á´£¿µ¤Àµ¥½´¤¼¸§¼º©¾·¨¸¶§·µ¥¸ªš­³ º´¡»´¡½±žºµ ºµ º³ž¸³ž¸°�·°
�·¯�µ³¡¹±�µ¯›³±Ÿ²² ³¯ ®­ž¬ªœ¨±£¯©˜¨¨—§©˜¨ª™¦š¦¥™˜¡¦™¢«—¦¥‘ ¤�¡£� ¢“£¥–
¦ ’¥Ÿ‘¤¡�ª �©ž‘¨¬Ÿ¶ ˜¥š’Ÿ™’�™’�œ’¡–Œ› “£Ÿ’¢
£“Ÿ£“Ÿ¢’ž¡‘��‘�ž’žš�˜¦›¤�’›�’›ž‘šŸ’› Ž˜�‹•�Œ”�Œ”š�’›‘“›‘“™�‘›ˆ•š‡”œŠ”�‹•˜ŽŽš��–
�‹”Ž‰”Ž‰–�‹•‘�–’Ž��������Ž‘‘�’”�‘“Œ”•Š”•Š˜™Œ•–‰˜—Šœ›Ž¢›“Ÿ˜� ™‘¡š’¢ —¡Ÿ–ŸŸ–ŸŸ–
¤Ÿ—¥ ˜£Ÿ• œ’ �Ž �Ž¡ž�£ ‘¥ž�¥ž�¦›�¢—Œ¢—Œ •Šž“ˆ •Šº¤“º¤“¸¤“¸¤“¶£–¶£–µ¡—¶¢
˜·Ÿš¶ž™µ¡™¸¤œµ¨–·ª˜³©–³©–·¦™¸§š¹¨›¹¨›¹¨›´£–«š�¸§š·¦™¶¥˜Ç³«¹¥�¸¡ ¸¡ ¶¡ ¸£¢
³¦›²¥š»±£·­Ÿ¼­ »¬Ÿ½«£½«£½¨§½¨§½¨§½¨§·ª¡»®¥º¯¦¹®¥¹¬¨¸«§¹¨«¹¨«»¥®¼¦¯¾¦¯¾¦¯À©¯¾§­
À¨±Á©²Ä©¹Á¦¶»¢²½¤´º¨­º¨­º¨­º¨­¾¤²»¡¯¿¥³À¦´Å®´· ¦Éµ¹¹¥©·¤¬¹¦®±Ÿ©·¥¯µ¨±´§°
¬§µ®©·™š±’“ªŽ’¯‘•²‹�¯‘“µ��°—šº ¦¼™Ÿµ�›ª–¡°Š›¤ŽŸ¨žª¶�›§…„›”“ª¯¦¾ —¯“‡›Ÿ“§­ °
´§··§³¶¦²·©°¸ª±¶­±²©­µ¬°¶­
±Å¶¿µ¦¯·§³¸¨´¶§µ¶§µ·¨¶¸©·»©³¹§±¼§´¾©¶¼¥¹¼¥¹º£¼º£¼¶¤¼¶¤¼³£»µ¥½²©»´«½¶ª¾¶ª¾º§Á»¨Â
¿§Ä»£À»¤½»¤½¼¤º¾¦¼½§¸»¥¶¸¤³»§¶¸ª¶¸ª¶¶ª¶¶ª¶µ¨¸µ¨¸µ¥¸µ¥¸º¨»º¨»¼§»¼§»¼¥¾»¤½¿¨Á¾§ÀÀ
¦»¸ž³¼¢·½£¸¹¤¸¹¤¸º¥¹¼§»º£¼¸¡º¸¤¼¹¥½·§º·§º¸¨»¶¦¹´�¶»¤½»£¾º¢½¶¢Á·£Â´¢Á´¢
Á³¡À³¡À¸§Ãµ¤À´¤¼³£»·¦»º©¾¶§·´¥µµ¥¸¶¦¹¶£½µ¢¼Ä±Í³ ¼µ º³ž¸³ž¸³ž¸°
�·¯œ¶¯�µ®œ´®š²±�µ² ³±Ÿ²®Ÿ­¬�«©›§¬žª¥”¤¨—§©˜¨«šª¥™¥¤˜¤¦™¢¥˜¡ª–¥¥‘ ¥‘¢¥‘¢¢“£
¢“£¡“¦¡“¦¡�ª¡�ª��§ž‘¨�•¢œ”¡›”Ÿ™’�œ’¡�“¢
Ÿ’¢ “££“Ÿ£“Ÿ �œžŽššŽššŽšš�˜�’›�’›š�˜œ�˜œ�˜žŒ–�‹•§–žž�•“‰‹™�‘š�’™�‘š‡”š‡”šˆ’�‹•—
��˜ŽŽ™“Ž–�‹‘‹†’Œ‡•‘�•‘�‘‘‘’’’““‘““‘’”�‘“Œ”•Š”•Š™š�–—Š—–‰
�œ�£œ”¡š’¡š’£œ”£¡˜£¡˜ŸŸ–  —š•�Ÿš’Ÿ›‘Ÿ›‘ �Ž �Žž›Œ¤¡’¨¡’¤�Ž¤™Ž¢—Œ£˜�¢—
Œž“ˆœ‘†¶§•´¥“¶¥˜·¦™²ž›±�š³ž˜¶¡›&

¥¥¥¥¥¥¥¥¥&

[Gość: ШЛЖ]

quran.al-islam.com/Default.asp
www.us-israel.org/jsource/myths/mftoc.html

¥¥¥¥¥¥¥¥¥&

[Gość: _:_]

Gość portalu: ШЛЖ napisał(a):

quran.al-islam.com/Default.asp
www.us-israel.org/jsource/myths/mftoc.html

_:_

¥¥¥¥¥¥¥¥¥

[datsh]

www.military.com/News/Home/0,13324,,00.html

¥¥¥¥¥¥¥¥ US ARMY

[datsh]

www.defenselink.mil/news/releases.html

[Gość: ©]

www.defenselink.mil/photos/Apr1996/960329-O-0000L-001.jpg

________________________

[Gość: _:_]

News July 09, 2002
Israel, PA agree to hold further contacts; collaborator shot dead in Gaza


Five Israeli soldiers sustained Tuesday mild to moderate injuries in the
Palestinian territories. A soldier was moderately injured in Tulkarem when he
tried to stop a Palestinian vehicle that skirted past an Israeli road-block.
Soldiers fired at the tires of the car and a bullet apparently ricocheted and
struck one of the soldiers in the leg, Haaretz reported.

Near Rafah on the Gaza Strip, according to Israeli sources, a malfunction in
an Israeli tank caused an explosion and injured four soldiers - none of them
seriously, the report added.

In Gaza, a Palestinian sentenced to death for collaborating with Israeli
security was shot and killed by Palestinian police while trying to escape, the
Palestinian prosecutor said. Hussam Hissi, 21, was convicted of helping Israel
kill five Palestinian activists.

On the political level, Israel and the Palestinians agreed on Tuesday to a
series of meetings after holding their first high-level talks in months.
Despite low expectations, the resumption of dialogue provided a rare glimmer
of hope that the two sides may be able to move forward.

Both sides said two days of meetings between Israeli Foreign Minister Shimon
Peres and Palestinian officials, including new Interior Minister Abdel-Razak
al-Yehiyeh, were not peace negotiations and they brought no major
breakthroughs. Peres' office said: "The meeting was good. Both sides
recognized the importance of continuing to talk."

Palestinian negotiator Saeb Erekat called for a resumption of full peace talks
after meeting Peres in Jerusalem. "We hope that the ultimate end result is not
just the mere fact that we are meeting but that we can do something...that we
can revive the peace process," he said, according to Reuters. "it is too soon
to speak about any movement as the result of one or two meetings with the
Israelis," he added.

Political sources said Israel had agreed to set up a committee to discuss the
matters raised during the talks and that it would study the possibility of
releasing Palestinian funds held in Israeli state coffers since the uprising
started.

Later in the day, the White House said U.S. President George W. Bush had
spoken by telephone to Sharon and Saudi Crown Prince Abdullah and urged them
to pursue peace.

"The president discussed with each of them the importance of pursuing the path
to peace in the Middle East. He discussed with each of them the
responsibilities of the various parties that do their part to help bring about
prospects for peace in the Middle East. And it was a very positive
conversation with each of them," spokesman Ari Fleischer said. (albawaba.com)

¯¯¯¯¯¯¯¯¯¯¯

[szpilberg]

—————————————————————————————————————————
————————————————————————————————————————
————————————————————————————————

¯¯¯¯¯¯¯¯¯¯¯&mac

[szpilberg]

szpilberg napisał:

> ——————————
> ——————————
> ;—————————̵
> 2;—————————R
> 12;—
> ——————————
> ;—————————̵
> 2;—————————R
> 12;—————————
> 212;
> ——————————
> ;—————————̵
> 2;—————————R
> 12;——

[drf]

A ja mam zupelnie inny obraz Pani Kunce....n/t

autor: Gość portalu: drf data: 19-08-2002 *.cm-upc.chello.se



sorry...linki sie skleily /tak jak kasza...

autor: Gość portalu: drf data: 17-08-2002 *.cm-upc.chello.se



koany zenu...?

autor: Gość portalu: drf data: 17-08-2002 *.cm-upc.chello.se



..........................czy lubisz kasze manną ?

autor: drf data: 17-08-2002



.....................................Kim jestem ?

autor: drf data: 15-08-2002



Do Pana Myślnika...

autor: drf data: 15-08-2002



Re: /////////////////////////////////////////////

autor: drf data: 15-08-2002



Re: GLOBALIZACJA !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

autor: drf data: 15-08-2002



Terraforming System

autor: drf data: 15-08-2002



..............................TAJEMNICA GLOBALIZMU

autor: Gość portalu: drf data: 15-08-2002 *.cm-upc.chello.se

[Gość: Sala]

Jak zdrowko?
<Piwo> dla Alefa
:))))))

Piwo

[Gość: Sala]

Gdybym mogla to bym Was zaprosila na:
Piwo Alef
Piwo DRF
Piwo Zupagrzybowa

3Piwa?

[Gość: ©]

subscriber.chello.se/spel/tetris/index.html

[Gość: Sala]

Ruska bladz !!!!
Łomonosow! Satelita

[Gość: DNA]

TTGAGCGGGGAGATGGGGGGTACCGTAGGGATGTTGAAGGGCACAGGTACAATGGGGATGTTGGCCACCGGCGAGGGGA
CCATGTGGATGTTGGCCGTCGGGATAGGCACCGTGAAGACCATGTTGAGGTTGATA

-------------------------------------------------------------------------------

dna2z.com/DNA-o-gram/encode.html

[sala.hamil]

Bravissimo

prasowka cnnu WAR OF WORDS

[Gość: (©)]

Sources: Missile ships may get orders; debate may go longer
High-level Arab delegation calls off Saddam visit
Thursday, March 13, 2003 Posted: 11:49 AM EST (1649 GMT)



Operations specalist Seaman Saint Layman writes the position of a contact on a
status board on the bridge aboard the aircraft carrier USS Kitty Hawk in the
Persian Gulf.

-------------------------------------------------------------------------------
-

Story Tools



-------------------------------------------------------------------------------
-

PERSPECTIVE

TIME.com's Tony Karon writes about the international debate in an article
titled "Why Bush Struggles To Win U.N. Backing":

"One reason the Bush administration can't get U.N. backing for war is that the
return of arms inspectors to Iraq has weakened rather than strengthened
international support for its position.

"That's because while the inspectors confirm that Iraq has not complied with
disarmament resolutions, their investigations have also knocked the wind out
of Washington's claims that Iraq has active, menacing chemical, biological and
nuclear weapons programs. Most U.N. member-states see a war as permissible
only if the threat from Iraq is greater than the dangers attached to going to
war

WAR OF PICTURES

[Gość: (©)]

politicalhumor.about.com/library/images/blsaddamfinalresolution.htm

[Gość: global_nav]

www.marvelicious.com/aprilfools.html
Central Command on April 11th said it had issued troops decks of playing cards
with photos of 55 regime figures being sought.

The Cards also were posted on the Defense Department’s Web site. The names
were also being put on posters and handbills for the Iraqi public. Curiously
absent is Saddam’s minister of information, Mohammed Saeed al-Sahhaf, who
boasted of battlefield successes right up to the time he disappeared Tuesday.
Saddam and his two sons are shown as aces, as is the presidential secretary,
Abid Hamid Mahmud al-Tikriti. And a familiar figure, Deputy Prime Minister
Tariq Aziz, is the eight of spades.

Others pictured on the cards are:
Ali Hasan al-Majid, also known as “Chemical Ali” for ordering the use of
chemical weapons on Iraq’s Kurds, who has been reported to have been killed;
Aziz Salih al-Numan, a Baath Party official; Izzat Ibrahim al-Duri,
Revolutionary Command Council vice chairman; Hani Abd al-Latif Tilfah, Special
Security Organization director; Muhammad Hamza Zubaydi, retired RCC member;
Muzahim Sa’b Asan, Air Defense Forces commander;
Kamal Mustafa Abdallah Sultan, secretary Republican Guard and Special
Republican Guard; Barzan Abd al-Ghafur Sulayman Majid, Special Republican
Guard commander; Ibrahim Ahmad Abd al-Sattar Muhammad, Iraqi Armed Forces
chief of staff; Tahir Jalil Habbush, Iraqi Intelligence Services; Sayf al-Din
Fulayyih Hasan Taha, Republican Guard chief of staff; Rafi Abd al-Latif
Tilfah, General Security director; Hamid Raja Shalah, Air Force commander;
Taha Yasin Ramadan, vice president and RCC member; Latif Nusayyif Jasim,
Baath Party Military Bureau deputy chairman; Abd al-Tawab Mullah Huwaysh,
deputy prime minister; Rukah Razuki Abd al-Ghafar Sulayman al-Majid, head of
Tribal Affairs Office; Taha Muhyi al-Din Maruf, vice president and RCC member;
Jamal Mustafa Abdallah Sultan, deputy head of Tribal Affairs Office; Mizban
Khadr Hadi, RCC member; Hikmat Mizban Ibrahim, deputy prime minister and
finance minister; Walid Hamid Tawfiq, governor of Basrah;
Sultan Hashim Ahmad, defense minister; Mahmud Dhiyab, interior minister; Amir
Hamudi Hasan, presidential science adviser; Ayad Futiyyah Khalifa, Quds Forces
chief of staff; Zuhayr Talib Abd al-Sattar, director of military intelligence;
Amir Rashid Muhammad, oil minister and presidential adviser; Sabawi Ibrahim
Hasan, presidential adviser; Husam Muhammad Amin, head of National Monitoring
Directorate; Muhammad Mahdi, trade minister; Watban Ibrahim Hasan,
presidential adviser; Abd al-Baqi Abd al-Karim Abdallah, Baath Party chairman
for Diyala District;
Barzan Ibrahim Hasan, presidential adviser; Huda Salih Mahdi Ammash, WMD
scientist/Baath Party regional command member; Muhammad Zimam Abd al-Razzaq,
Baath Party regional command chairman for the Ta’mim district; Yahya Abdallah,
Baath Party regional command chairman for Basrah district; Samir Abd al-Aziz;
Baath Party regional command chairman for east Baghdad district; Humam Abd al-
Khaliq Abd al-Ghafur, minister of higher education and scientific research;
Sa’d Abdul-Majid al-Faisal, Baath Party regional command chairman for Salah al-
Din district; Muhsin Khadr al-Khafaji, Baath Party regional command chairman
for Qadisiyah district;
Sayf al-Din al-Mashhadani, Baath Party regional command chairman for Muthanna
district; Fadil Mahmud Gharib, Baath Party regional command chairman for Babil
district; Rashid Taan Kazim, Baath Party regional chairman for al-Anbar
district; Adil Abdallah Mahdi, Baath Party regional command chairman for Dhi
Qar district; Ugla Abid Saqral-Qubaysi, Baath Party regional chairman for
Maysan district; Ghazi Hammud al-Ubaydi, Baath Party regional command chairman
for al-Kut district.


www.gagsplus.com/cards/index.shtml
www.macromedia.com/special/progress_report/beta5/global_nav/

WARdelta5

[Gość: ***}]

a1775.v8158d.c8158.g.vr.akamaistream.net:8080/viewsource/template.html?nuyhtger0qz6pn48se9knxkeE0h85774key6fmvn58161157dyah4e6h05ngbC7n5gs7fj4ewD7Argp
wlh4eob53memm6Ea7jr1cm6qD1wE7vr86E6e8cfng

WARdelta6

[Gość: =x=]

a1775.v8158d.c8158.g.vr.akamaistream.net:8080/viewsource/template.html?nuyhtger0qz6pn48se9knxkeE0h85774key6fmvn58161157dyah4e6h05ngbC7n5gs7fj4ewD7Argp

RealityTV

[Gość: *!*}]

www.nynewsday.com/entertainment/tv/nyc-lewinsky0421,0,6123776.story?coll=nyc%2Dmanheadlines%2Dtv


www.penguinputnam.com/Book/BookFrame/?0670031909_EXC

www.nynewsday.com/features/booksmags/ny-devilprada,0,1701949.realaudio?coll=nyc%2Dmanheadlines%2Dbooks

irRealityTV

[Gość: Xeno]

members.telering.at/pat/slidep6.htm
members.telering.at/pat/slidehp7.htm
members.telering.at/pat/slidehp3.htm
fcit.usf.edu/Holocaust//arts/ARTPROP.HTM

*************AmericanVictory******************

[Gość: al Haj]

www.iraqifreedom.us/index.htm

1676

[Gość: 2004]

burningword.com/presentations.php?task=view&articleID=134
Weltgeschichte

Türkenkrieg (1683-1699).

Der gerade mit dem kaiserlichen Oberbefehl versehene Prinz Eugen von Savoyen
besiegt die Türken entscheidend in der Schlacht bei Zenta.

Bei der Bewerbung um die polnische Krone setzt sich Kurfürst Friedrich August
I. (der Starke) von Sachsen mit russischer und österreichischer Unterstützung
gegen den gewählten Franzosen Conti durch. Allerdings mußte August erst
Katholik werden.

In Rußland tritt Zar Peter I. seine (inkognito-) Europareise an, um Eindrücke
und Kenntnisse für die Europäisierung seines Reiches zu bekommen. Derweil
erobern die Kosaken für ihn in den folgenden zwei Jahren Kamtschatka.

In Stockholm beginnt man mit dem Bau des Königsschlosses und der
Dreifaltigkeitskirche.

www.nysm.nysed.gov/albany/census1697.html

1998

[Gość: unix]

www.fsf.org/home.pl.html

60 = 2x2x3x5

[Gość: 2235]

210

[Gość: 2357_]

23 57 .....

}}}}}}}

--------------------1701------------------

[Gość: 5886973]

forum.gazeta.pl/forum/72,2.html?f=13&w=741459&a=5886973

--------------------17771------------------

[Gość: alef-3]

picture gallery "italian period 1922 - 1935"

San Gimignano 1923 woodcut

Dolphins 1923 woodcut

Self-Portrait 1922 woodcut

Portrait of Jetta 1925 woodcut


Vitorchiano nel Cimino 1925 woodcut


The First Day of the Creation 1925 woodcut

The Sixth Day of Creation 1926 woodcut


The Fall of Man 1927 woodcut


Procession in Crypt 1927 woodcut


Rome 1927 woodcut in grey and black, printed from 2 blocks



Castle in the Air 1928 woodcut


Tower of Babel 1928 woodcut


Fara San Martino, Abruzzi 1928 woodcut printed on 2 sheets


Corte, Corsica 1929 woodcut in grey and black, printed from 2 blocks


The Drowned Cathedral 1929 woodcut



Infant Arthur Esher 1929 woodcut in reddish brown and 2 tones of pink, printed
from 3 blocks


Self-Portrait 1929 Lithograph


Barbarano, Cimino 1929 Lithograph


Street in Scanno, Abruzzi 1930 woodcut


Castrovalva 1930 Lithograph



The Bridge 1930 Lithograph


Fiumara, Calabria 1930 Lithograph


Tropea, Calabria 1931 Lithograph


Cloister near Rocca Imperiale, Calabria 1931 Lithograph


Atrani, Coast of Amalfi 1931 Lithograph



Covered Alley in Atrani 1931 wood engraving


Ravello and the Coast of Amalvi 1931 Lithograph


Coast of Amalvi 1931 woodcut in black and various tones of grey


Farmhouse, Ravello 1931 Lithograph


San Cosimo, Ravello 1932 Lithograph




Turello, Southern Italy 1932 Lithograph


Porta Maria dell' Ospidale, Ravello 1932 wood engraving


Lion of the Fountain in the Piazza at Ravello 1932 wood engraving


San Michele dei Frisone, Rome 1932 Lithograph


Mumified Priests in Gangi, Sicily 1932 Lithograph



Temple of Segeste, Sicily 1932 wood engraving


Cave Dwellings (near Sperlinga) Sicily 1933 woodcut


Palm 1933 wood engraving in black and grey-green


Caltavuturo in the Madonie Mountains Sicily 1933 Lithograph


Cloister of Monreale Sicily 1933 wood engraving



Lava Flow of 1928 from Etna Sicily 1933 Lithograph


Pineta of Calvi, Corsica 1933 woodcut in light grey, dark grey and black


Phosphorescent Sea 1933 Lithograph


Fireworks 1933 Lithograph


Old Olive Tree, Corsica 1934 wood engraving


Nonza, Corsica 1934 Lithograph


Still Live with Mirror 1934 Lithograph


Nocturnal Rome: Colonade of St Peter's 1934 woodcut


Nocturnal Rome: Santa Maria del Popolo 1934 woodcut


Nocturnal Rome: Trajan's Column 1934 woodcut



Nocturnal Rome: Basilica of Constantine 1934 woodcut


Nocturnal Rome: Castel Sant' Angelo 1934 woodcut


Nocturnal Rome: Colosseum 1934 woodcut


Aeroplane above Snowy Landscape 1934 woodcut; proof


Still Life with Spherical Mirror 1934 Lithograph



Hand with Reflecting Sphere 1935 Lithograph


Inside St Peter's 1935 wood engraving


Portrait of G.A. Escher 1935 Lithograph


Sengela, Malta 1935 woodcut


Hell, copy after Hieronymus Bosch 1935 Lithograph

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
-----------------------------------------------------------------
<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

www.mcescher.com/Gallery/ital-bmp/LW116.jpg
www.mcescher.com/Gallery/ital-bmp/LW118.jpg
www.mcescher.com/Gallery/ital-bmp/LW132.jpg
www.mcescher.com/Gallery/ital-bmp/LW134.jpg

PICTURES OF PEACE !!!

[Gość: * }]

www.mcescher.com/Gallery/gallery-back.html
..................................................
www.mcescher.com/Gallery/switz-bmp/LW296.jpg
www.mcescher.com/Gallery/switz-bmp/LW303.jpg
www.mcescher.com/Gallery/switz-bmp/LW305.jpg
www.mcescher.com/Gallery/back-bmp/LW334.jpg
www.mcescher.com/Gallery/back-bmp/LW339.jpg
www.mcescher.com/Gallery/back-bmp/LW348.jpg
www.mcescher.com/Gallery/recogn-bmp/LW448.jpg
www.mcescher.com/Gallery/back-bmp/LW346.jpg
www.mcescher.com/Gallery/back-bmp/LW358.jpg
www.mcescher.com/Gallery/back-bmp/LW395.jpg.............................................................