Gość: NY Beyond a reasonable doubt IP: *.cm-upc.chello.se 13.04.02, 16:33 Beyond a reasonable doubt -------------------------------------------------------------------------------- Column One By Caroline Glick April, 12 2002 -------------------------------------------------------------------------------- (April 12) - In his address to the Knesset earlier this week, Prime Minister Ariel Sharon laid the groundwork for a possible indictment of Palestinian Authority Chairman Yasser Arafat for war crimes. Let's review the evidence to help US Secretary of State Colin Powell prepare for his meeting with Arafat tomorrow. Sharon read from two documents confiscated from Arafat's headquarters in Ramallah during IDF operations. The first document, dated January 7, 2002, is a request from Raed Karmi, then head of Fatah-Tanzim in the Tulkarm area, addressed to his chief, Marwan Barghouti, asking for financial assistance for 12 Fatah terrorists serving under his command. Barghouti forwarded the letter to Arafat, with a note, "I request of you to order the allocation of $1,000 for each of the fighter brethren." At the bottom of the document is a handwritten note signed by Arafat, "Please allocate $350 to each." The second document, dated September 19, 2001, is a letter to Arafat from senior Fatah leader in the West Bank Hussein al-Sheikh requesting Karmi, Ziad Muhammad Daas, and Amar Qadan receive payments of $2,500 apiece. Daas is the commander of the Fatah-Tanzim cell which carried out the massacre at Nina Kardashov's bat mitzva party in Hadera this past January, and Amar Qadan is a senior terrorist operative from Force 17 in Ramallah. At the bottom of the document is a note in Arafat's handwriting over his signature to "Treasury/Ramallah" with the instruction to "allocate $600 to each of them." A third document confiscated by the IDF, which Sharon refrained from mentioning, is an undated status report regarding Fatah terrorist cells in Tulkarm, and it is nothing less than devastating to anyone wishing to claim the Palestinian Authority is anything other than a terrorist organization. The document is addressed to Tawfik Tirawi, commander of the General Intelligence Service in the northern West Bank, and written by Hamdi al- Darduch, its Tulkarm district commander. Praising Ziad Daas and his men, Darduch writes, "This squad has carried out high quality, successful attacks. Their latest operation was the coordination and planning of the operation in Hadera. [That is, the murder of six Israelis at the bat mitzva party.] This squad is the most disciplined, and its men... are very close to us and are continuously coordinated and in contact with us." At the outset of the document, Darduch explained that three of the M-16 rifles possessed by Fatah-Tanzim gunmen in his district were financed by Tanzim "as well as through donations and financial assistance from the Honorable President [Arafat]." Toward the end of his report, Darduch, bemoans the rivalries among the various terrorist cells and between them and the General Intelligence Directorate, complaining that all the infighting is taking place "at the time when we've finally reached the understanding that Fatah gunmen constitute, first and foremost, a support and auxiliary force for the PA and its security apparatuses." Darduch, however, takes heart in the fact that "among the Fatah gunmen are brothers who are prominent in their activities, steadfast in their loyalty to the Fatah and in their understanding of the political situation and what is demanded at every one of the political stages." Their activities, he says, are funded by the Tanzim Secretariat in Tulkarm as well as by the "emergency budget" which, the IDF explains, is "apparently the funds transferred by the PA leadership through the 'Emergency Committee' chaired by Hakam Balawi." In his recommendations to his commander, Darduch writes, "We have to get rid of a number of parasites who have penetrated the ranks of the gunmen but have not shot one bullet at the Israelis." These three documents constitute direct and indirect evidence of Arafat's command and control over Palestinian terrorism. His signed notes unequivocally implicate him as the direct commander of major terrorist operatives who have planned and coordinated attacks against scores of Israelis. He decides who will get paid and how much. Darduch's report proves there is no difference between the PA and terrorist cells. Arafat finances weapons procurement down to the individual rifle, and his security apparatuses fund, coordinate, participate in, and oversee the activities of the terrorist cells. Apologists for Arafat would argue that since the sums he allocated to the various terrorist leaders in the seized documents are small, it cannot possibly follow that he is in charge of them. However, a more likely explanation is that Arafat holds absolute control over everything that happens in the PA, down to the last rifle and penny. This latter explanation was reached in another context by the US Council on Foreign Relations in June 1999. At that time, the council published a report on the state of the PA, commissioned by the EU. In its report, authored by Henry Siegman and Terje Larsen (two well-known advocates of Yasser Arafat), the council found Arafat concentrates decision-making authority in his own hands to the point where "he personally approves all senior officials' vacations and per diem expenses." Against this backdrop, Arafat's contention to US President George W. Bush, which was wistfully echoed for a time by the US State Department and the EU, that he did not know about the $500,000 spent on the purchase of the Karine A weapons ship - or the $10 million paid to Iran for its cargo of missiles, missile launchers, C4 explosive, mines, mortars, hand grenades, machine guns, and ammunition - becomes patently ridiculous. The contention that Arafat does not control the terrorists is also rendered unsupportable. To the documented proof of Arafat's direct command over the Fatah-Tanzim terrorist infrastructure must be added his collusion with Islamic Jihad and Hamas. At the outset of the Palestinian terrorist war, Arafat's underling Barghouti formed the "Unified Command of the Intifada," which coordinates attacks with Islamic Jihad and Hamas. The fact the PA itself is part and parcel of the Palestinian terrorist infrastructure was further brought home when the IDF discovered weapons-making workshops inside the Palestinian Security Service's compound in Yatta. Arafat's operations are not limited to the West Bank and Gaza Strip, but involve at least two members of Bush's "axis of evil." Last week, the Sunday Telegraph reported Western intelligence sources claim an Arafat aide met last month with Iraqi intelligence officials and provided them with a list of strategic targets inside Israel and Saudi Arabia. The sources also said Arafat's aide provided Iraqi intelligence with 37 forged passports. On the subject of forgeries, in their raid of Arafat's headquarters, soldiers uncovered huge sums of counterfeit US dollars and shekels. Arafat is holed up in his compound with Fuad Shubaki, who financed the Karine A operation as he does all of the PA's weapons procurements. Shubaki and Fathi al-Razem, deputy commander of the Palestinian Naval Police, have been, according to American and Israeli intelligence officials, Arafat's point men in developing close ties with the Iranian regime since last May. Perhaps Arafat gained counterfeiting expertise through his close connections with the Iranian government - which had produced such sophisticated forgeries of the dollar and shekel in the mid-1990s that both countries were forced to design and issue new bills. Arafat, throughout his long career as a master terrorist, has culti Odpowiedz Link Zgłoś
Gość: NY Beyond a reasonable doubt 2 IP: *.cm-upc.chello.se 13.04.02, 16:36 Arafat, throughout his long career as a master terrorist, has cultivated "plausible deniability" into an art form. In the 1970s, attacks were carried out by PLO factions in their own name, (Black September, the PFLP, the DFLP, the PFLP Central Command, and so on). This state of affairs allowed Arafat to simultaneously command terrorist operations and feign innocence, touting himself as a "political leader" much as he does today. The hard evidence of Arafat's direct command over all aspects of the Palestinian terrorist war against Israel provided by the documents seized by the IDF since the onset of Operation Defensive Shield, together with the indirect evidence provided by intelligence reports, his harboring of wanted terrorists in Ramallah (aside from Shubaki, Arafat is also hosting the murderers of tourism minister Rehavam Ze'evi), the presence of illicit weapons- making workshops in his command posts, and the fact that all Palestinian terrorists name him as their supreme commander, render his deniability implausible. It could easily be argued the documentary evidence alone provides a more convincing case of Arafat's direct responsibility for terrorism than the US government has presented regarding Osama bin Laden's responsibility for the September 11 attacks. Israel has proven Arafat pays terrorists. The US has not shown direct proof bin Laden personally oversees payments to Al-Qaida terrorists. In 1989, the Palestinian National Council, the PLO's legislative arm, purported to become a party to the Geneva Conventions. Article 146 of the Fourth Geneva Convention stipulates, "Each high contracting party shall be under the obligation to search for persons alleged to have committed or to have ordered to be committed such grave breaches and shall bring such persons, regardless of their nationality before its own courts." Among the "grave breaches" listed is murder. Powell has repeatedly and emphatically stated his position that Arafat is a legitimate leader and the road to peace goes through him. Given the evidence here presented, and additional findings that have been streaming in since interrogations of Palestinian prisoners began in earnest this week, perhaps the time has come for him to rethink this position. www.jpost.com/Editions/2002/04/12/News/News.46842.html Odpowiedz Link Zgłoś
Gość: SE WAKACJE Z MISIEM IP: *.cm-upc.chello.se 14.04.02, 04:50 www.tango.dk/misio/ Odpowiedz Link Zgłoś
Gość: פרןצק ALE NUMERY !!!!!!!!!!!!!!!!!!!!!!!!!!!!!! IP: *.cm-upc.chello.se 14.04.02, 19:22 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97 101 103 107 109 113 127 131 137 139 149 151 157 163 167 173 179 181 191 193 197 199 211 223 227 229 233 239 241 251 257 263 269 271 277 281 283 293 307 311 313 317 331 337 347 349 353 359 367 373 379 383 389 397 401 409 419 421 431 433 439 443 449 457 461 463 467 479 487 491 499 503 509 521 523 541 547 557 563 569 571 577 587 593 599 601 607 613 617 619 631 641 643 647 653 659 661 673 677 683 691 701 709 719 727 733 739 743 751 757 761 769 773 787 797 809 811 821 823 827 829 839 853 857 859 863 877 881 883 887 907 911 919 929 937 941 947 953 967 971 977 983 991 997 1009 1013 1019 1021 1031 1033 1039 1049 1051 1061 1063 1069 1087 1091 1093 1097 1103 1109 1117 1123 1129 1151 1153 1163 1171 1181 1187 1193 1201 1213 1217 1223 1229 1231 1237 1249 1259 1277 1279 1283 1289 1291 1297 1301 1303 1307 1319 1321 1327 1361 1367 1373 1381 1399 1409 1423 1427 1429 1433 1439 1447 1451 1453 1459 1471 1481 1483 1487 1489 1493 1499 1511 1523 1531 1543 1549 1553 1559 1567 1571 1579 1583 1597 1601 1607 1609 1613 1619 1621 1627 1637 1657 1663 1667 1669 1693 1697 1699 1709 1721 1723 1733 1741 1747 1753 1759 1777 1783 1787 1789 1801 1811 1823 1831 1847 1861 1867 1871 1873 1877 1879 1889 1901 1907 1913 1931 1933 1949 1951 1973 1979 1987 1993 1997 1999 2003 2011 2017 2027 2029 2039 2053 2063 2069 2081 2083 2087 2089 2099 2111 2113 2129 2131 2137 2141 2143 2153 2161 2179 2203 2207 2213 2221 2237 2239 2243 2251 2267 2269 2273 2281 2287 2293 2297 2309 2311 2333 2339 2341 2347 2351 2357 2371 2377 2381 2383 2389 2393 2399 2411 2417 2423 2437 2441 2447 2459 2467 2473 2477 2503 2521 2531 2539 2543 2549 2551 2557 2579 2591 2593 2609 2617 2621 2633 2647 2657 2659 2663 2671 2677 2683 2687 2689 2693 2699 2707 2711 2713 2719 2729 2731 2741 2749 2753 2767 2777 2789 2791 2797 2801 2803 2819 2833 2837 2843 2851 2857 2861 2879 2887 2897 2903 2909 2917 2927 2939 2953 2957 2963 2969 2971 2999 3001 3011 3019 3023 3037 3041 3049 3061 3067 3079 3083 3089 3109 3119 3121 3137 3163 3167 3169 3181 3187 3191 3203 3209 3217 3221 3229 3251 3253 3257 3259 3271 3299 3301 3307 3313 3319 3323 3329 3331 3343 3347 3359 3361 3371 3373 3389 3391 3407 3413 3433 3449 3457 3461 3463 3467 3469 3491 3499 3511 3517 3527 3529 3533 3539 3541 3547 3557 3559 3571 3581 3583 3593 3607 3613 3617 3623 3631 3637 3643 3659 3671 3673 3677 3691 3697 3701 3709 3719 3727 3733 3739 3761 3767 3769 3779 3793 3797 3803 3821 3823 3833 3847 3851 3853 3863 3877 3881 3889 3907 3911 3917 3919 3923 3929 3931 3943 3947 3967 3989 4001 4003 4007 4013 4019 4021 4027 4049 4051 4057 4073 4079 4091 4093 4099 4111 4127 4129 4133 4139 4153 4157 4159 4177 4201 4211 4217 4219 4229 4231 4241 4243 4253 4259 4261 4271 4273 4283 4289 4297 4327 4337 4339 4349 4357 4363 4373 4391 4397 4409 4421 4423 4441 4447 4451 4457 4463 4481 4483 4493 4507 4513 4517 4519 4523 4547 4549 4561 4567 4583 4591 4597 4603 4621 4637 4639 4643 4649 4651 4657 4663 4673 4679 4691 4703 4721 4723 4729 4733 4751 4759 4783 4787 4789 4793 4799 4801 4813 4817 4831 4861 4871 4877 4889 4903 4909 4919 4931 4933 4937 4943 4951 4957 4967 4969 4973 4987 4993 4999 5003 5009 5011 5021 5023 5039 5051 5059 5077 5081 5087 5099 5101 5107 5113 5119 5147 5153 5167 5171 5179 5189 5197 5209 5227 5231 5233 5237 5261 5273 5279 5281 5297 5303 5309 5323 5333 5347 5351 5381 5387 5393 5399 5407 5413 5417 5419 5431 5437 5441 5443 5449 5471 5477 5479 5483 5501 5503 5507 5519 5521 5527 5531 5557 5563 5569 5573 5581 5591 5623 5639 5641 5647 5651 5653 5657 5659 5669 5683 5689 5693 5701 5711 5717 5737 5741 5743 5749 5779 5783 5791 5801 5807 5813 5821 5827 5839 5843 5849 5851 5857 5861 5867 5869 5879 5881 5897 5903 5923 5927 5939 5953 5981 5987 6007 6011 6029 6037 6043 6047 6053 6067 6073 6079 6089 6091 6101 6113 6121 6131 6133 6143 6151 6163 6173 6197 6199 6203 6211 6217 6221 6229 6247 6257 6263 6269 6271 6277 6287 6299 6301 6311 6317 6323 6329 6337 6343 6353 6359 6361 6367 6373 6379 6389 6397 6421 6427 6449 6451 6469 6473 6481 6491 6521 6529 6547 6551 6553 6563 6569 6571 6577 6581 6599 6607 6619 6637 6653 6659 6661 6673 6679 6689 6691 6701 6703 6709 6719 6733 6737 6761 6763 6779 6781 6791 6793 6803 6823 6827 6829 6833 6841 6857 6863 6869 6871 6883 6899 6907 6911 6917 6947 6949 6959 6961 6967 6971 6977 6983 6991 6997 7001 7013 7019 7027 7039 7043 7057 7069 7079 7103 7109 7121 7127 7129 7151 7159 7177 7187 7193 7207 7211 7213 7219 7229 7237 7243 7247 7253 7283 7297 7307 7309 7321 7331 7333 7349 7351 7369 7393 7411 7417 7433 7451 7457 7459 7477 7481 7487 7489 7499 7507 7517 7523 7529 7537 7541 7547 7549 7559 7561 7573 7577 7583 7589 7591 7603 7607 7621 7639 7643 7649 7669 7673 7681 7687 7691 7699 7703 7717 7723 7727 7741 7753 7757 7759 7789 7793 7817 7823 7829 7841 7853 7867 7873 7877 7879 7883 7901 7907 7919 7927 7933 7937 7949 7951 7963 7993 8009 8011 8017 8039 8053 8059 8069 8081 8087 8089 8093 8101 8111 8117 8123 8147 8161 8167 8171 8179 8191 8209 8219 8221 8231 8233 8237 8243 8263 8269 8273 8287 8291 8293 8297 8311 8317 8329 8353 8363 8369 8377 8387 8389 8419 8423 8429 8431 8443 8447 8461 8467 8501 8513 8521 8527 8537 8539 8543 8563 8573 8581 8597 8599 8609 8623 8627 8629 8641 8647 8663 8669 8677 8681 8689 8693 8699 8707 8713 8719 8731 8737 8741 8747 8753 8761 8779 8783 8803 8807 8819 8821 8831 8837 8839 8849 8861 8863 8867 8887 8893 8923 8929 8933 8941 8951 8963 8969 8971 8999 9001 9007 9011 9013 9029 9041 9043 9049 9059 9067 9091 9103 9109 9127 9133 9137 9151 9157 9161 9173 9181 9187 9199 9203 9209 9221 9227 9239 9241 9257 9277 9281 9283 9293 9311 9319 9323 9337 9341 9343 9349 9371 9377 9391 9397 9403 9413 9419 9421 9431 9433 9437 9439 9461 9463 9467 9473 9479 9491 9497 9511 9521 9533 9539 9547 9551 9587 9601 9613 9619 9623 9629 9631 9643 9649 9661 9677 9679 9689 9697 9719 9721 9733 9739 9743 9749 9767 9769 9781 9787 9791 9803 9811 9817 9829 9833 9839 9851 9857 9859 9871 9883 9887 9901 9907 9923 9929 9931 9941 9949 9967 9973 10007 10009 10037 10039 10061 10067 10069 10079 10091 10093 10099 10103 10111 10133 10139 10141 10151 10159 10163 10169 10177 10181 10193 10211 10223 10243 10247 10253 10259 10267 10271 10273 10289 10301 10303 10313 10321 10331 10333 10337 10343 10357 10369 10391 10399 10427 10429 10433 10453 10457 10459 10463 10477 10487 10499 10501 10513 10529 10531 10559 10567 10589 10597 10601 10607 10613 10627 10631 10639 10651 10657 10663 10667 10687 10691 10709 10711 10723 10729 10733 10739 10753 10771 10781 10789 10799 10831 10837 10847 10853 10859 10861 10867 10883 10889 10891 10903 10909 10937 10939 10949 10957 10973 10979 10987 10993 11003 11027 11047 11057 11059 11069 11071 11083 11087 11093 11113 11117 Odpowiedz Link Zgłoś
Gość: SE MISJA dla MISIA IP: *.cm-upc.chello.se 15.11.02, 21:29 http://www.fsu.edu/~trauma/v6i3/v6i3a3.html Volume VI, Issue 3, Article 3 (October, 2000) ------------------------------------------------------------------------------- - Sensorimotor Psychotherapy: One Method for Processing Traumatic Memory Pat Ogden, M.A. and Kekuni Minton, PhD. Hakomi Somatics Institute and Naropa University Boulder, Colorado ------------------------------------------------------------------------------- - Abstract Traditional psychotherapy addresses the cognitive and emotional elements of trauma, but lacks techniques that work directly with the physiological elements, despite the fact that trauma profoundly affects the body and many symptoms of traumatized individuals are somatically based. Altered relationships among cognitive, emotional, and sensorimotor (body) levels of information processing are also found to be implicated in trauma symptoms. Sensorimotor Psychotherapy is a method that integrates sensorimotor processing with cognitive and emotional processing in the treatment of trauma. Unassimilated somatic responses evoked in trauma involving both arousal and defensive responses are shown to contribute to many PTSD symptoms and to be critical elements in the use of Sensorimotor Psychotherapy. By using the body (rather than cognition or emotion) as a primary entry point in processing trauma, Sensorimotor Psychotherapy directly treats the effects of trauma on the body, which in turn facilitates emotional and cognitive processing. This method is especially beneficial for clinicians working with dissociation, emotional reactivity or flat affect, frozen states or hyperarousal and other PTSD symptoms. In this article, we discuss Sensorimotor Psychotherapy, emphasizing sensorimotor processing techniques which can be integrated with traditional approaches that treat these symptoms. Because the therapist's ability to interactively regulate clients' dysregulated states and also to cultivate clients' self-awareness of inner body sensations is crucial to this approach, three sessions are described illustrating the clinical application of this method. ------------------------------------------------------------------------------- - Sensorimotor Psychotherapy is a method for facilitating the processing of unassimilated sensorimotor reactions to trauma and for resolving the destructive effects of these reactions on cognitive and emotional experience. These sensorimotor reactions consist of sequential physical and sensory patterns involving autonomic nervous system arousal and orienting/defensive responses which seek to resolve to a point of rest and satisfaction in the body. During a traumatic event such a satisfactory resolution of responses might be accomplished by successfully fighting or fleeing. However, for the majority of traumatized clients, this does not occur. Traumatized individuals are plagued by the return of dissociated, incomplete or ineffective sensorimotor reactions in such forms as intrusive images, sounds, smells, body sensations, physical pain, constriction, numbing and the inability to modulate arousal. These unresolved sensorimotor reactions condition emotional and cognitive processing, often disrupting the traumatized person's ability to think clearly or to glean accurate information from emotional states (Van der Kolk, 1996). Conversely, cognitive beliefs and emotional states condition somatic processing. For instance, a belief such as "I am helpless" may interrupt sensorimotor processes of active physical defense; an emotion such as fear may cause sensorimotor processes such as arousal to escalate. Most psychotherapeutic approaches favor emotional and cognitive processing over body processing, and it has been shown that such approaches can greatly relieve trauma symptoms. However, since somatic symptoms are significant in traumatization (McFarlane, 1996, p. 172) the efficacy of trauma treatment may be increased by the addition of interventions that facilitate sensorimotor processing. We propose that sensorimotor processing interventions can help regulate and facilitate emotional and cognitive processing, and we find that confronting somatic issues by directly addressing sensorimotor processing can be useful in restoring normal healthy functioning for victims of trauma regardless of the nature of the trauma's origin. However, we also find that sensorimotor processing alone is insufficient; the integration of all three levels of processing Odpowiedz Link Zgłoś
Gość: 1995 SIERPIEN IP: *.cm-upc.chello.se 14.04.02, 22:03 4 04-09-1995 tajemnica? ?אשחקצמןבש Odpowiedz Link Zgłoś
alef1 &# 932;&# 917;&# 931;&# 932; 15.04.02, 03:23 אקדא ЕУЫЕ ____________ ΤУΤא ЕדЕא ΣקΕЫ Odpowiedz Link Zgłoś
Gość: ВкА SHALOM ELOHIM IP: *.cm-upc.chello.se 15.04.02, 03:51 was macht a Jidd? iz redst man iddsh... com.id F אAα Tρן 'цW ZEN ζקn koan лщфт לםשמ ................... koлשф מщ לם .. . . . . . тan Odpowiedz Link Zgłoś
Gość: * Sharon warns of spread of suicide bomber IP: *.cm-upc.chello.se 21.04.02, 01:33 Sharon warns of spread of suicide bomber phenomenon By David Rudge The phenomenon of suicide bombings could spread like wildfire throughout other parts of the world, Prime Minister Ariel Sharon warned yesterday. "The question of suicide terror is primarily our problem today, but the danger is very great and this is something that could spread like fire throughout the world, because it is a relatively shorter process," Sharon said. Sharon made his remarks during a visit to Haifa's Rambam Hospital. He said there were indications the suicide bomber phenomenon is taking root among Israeli Arabs. "Unfortunately, we are seeing signs, which I hope are extraordinary incidents, of this among the population in Israel. I say out of the ordinary but, unfortunately, it has started and does exist," Sharon said. "I hope that all those who understand that we will always have to be together will stop even any tiny trace of such an intention." Despite the current situation, he still hopes to see the Palestinians join what he described as a coalition of peace. He stressed, however, this depends on the Palestinians fulfilling their obligations, as well as on progress in negotiations aimed at achieving a cease- fire. "I see two coalitions that exist in the region," Sharon said, "a coalition of war of Iran, Iraq, and Syria, opposite a coalition of... peace of Israel, Egypt, Jordan, Saudi Arabia, perhaps Morocco, and the Palestinians. "Today, with them [the Palestinians], this is not the situation, but I hope the day will come and this is what will be. "I see this as a peace coalition, and I have proposed convening a [regional] conference that would sit and deal with different issues, from political issues to economic and social ones - issues connected to the development of this area and utilizing the tremendous potential that exists, if there is the desire to assist." Odpowiedz Link Zgłoś
Gość: _¨¨¨¨¨¨_ _________¨¨¨¨¨¨¨¨_________________________________ IP: *.cm-upc.chello.se 16.04.02, 20:33 σμα ισραελ αδοναι ελοηεινθ αδοναξ εηαδ Odpowiedz Link Zgłoś
alef1 ______O___R____I____E___N___T______ 17.04.02, 00:13 www.1000and1.de/ www.1000and1.de/forum/index_e.htm www.1000and1.de/picture/jpg/matahar.jpg www.1000and1.de/picture/portrait/eshtar2.jpg www.1000and1.de/picture/portrait/zeynep2.jpg www.1000and1.de/forum/index_e.htm ************************ Lydia Tzigane Click on Picture for more! Lydia Tzigane lives in Sharjah, a city in the United Arabic Emirates and performs mostly in Dubai. Since 1984 she has espoused the oriental dance and has shown her knowledge of art already in many of the large hotels of the middle east. A long time she has a dream, to become a dancer, if she has thought also initially sooner about a career in the ballet. Then however she got to know the oriental culture and and she love it. So she began to learn the oriental dance. The feeling for this dance has gotten put Lydia well about her Origin, she is an Romanov Gipsy. She began her dance-career in Egypt and the persons there pleased here dancestyle and work so well, that she was booked more and more for appearances, and from there she got more and more bookings and contracts. There followed firm engagements in many important hotels of the middle east. Lydia Tzigane has found her own style. She says over herself: "I love it because it is a free form of dancing ,there are some rules and basics ,but every dancer can put her own soul and fire in it,to make it special for her and her liking,that is why i like it you can grow and learn every day in this dancing,put more wood on the fire and the flames becomes bigger. It never stops, it is a beautiful artform, and fills your soul." "Tahaya Karyoka,told me when i met her in Egypt,to stay as i was ,not to copy any other dancer and to became my own identety, so people would remember me,with my own style,that is what i never forgot,and it worked!! people always tell me -- you are different Odpowiedz Link Zgłoś
alef1 _____________NY_______________ 17.04.02, 01:08 www.earthcam.com/usa/newyork/timessquare/ Odpowiedz Link Zgłoś
Gość: :///\\\: Re: _________¨¨¨¨¨¨¨¨_________________________________ IP: *.cm-upc.chello.se 15.05.02, 17:34 354 attacks found Date: Nov 9, 2001 Organization: Martyrs of al-Aqsa Attack Type: Shooting Target Type: Vehicle Location: Near Yabed rubbish dump, West Bank Casualties: Killed: 1 Injured: 0 Details: Hadas Abutbul, 39, of Mevo Dotan in northern Samaria was shot and killed by Palestinian terrorists on Friday afternoon as she drove from work in nearby Shaked. More information Date: Nov 4, 2001 Organization: Palestinian Islamic Jihad (PIJ) Attack Type: Shooting Target Type: Bus Location: French Hill, Jerusalem, Israel Casualties: Killed: 2 Injured: 45 Number of Terrorists Involved: 1 Details: A Palestinian gunman opened fire on a No. 25 Egged bus at the French Hill junction in northern Jerusalem. A 14-year-old boy and a 16-year-old girl returning home from school were killed, and more than 40 were wounded. Two of the wounded, one a 14-year-old girl who was shot in the head, were in serious but stable condition in hospital. More information -------------------------------------------------------------- ------------------ Date: Nov 2, 2001 Organization: Martyrs of al-Aqsa Attack Type: Shooting Target Type: Military Personnel Location: IDF roadblock near Ofra, West Bank Casualties: Killed: 1 Injured: 1 Details: St.-Sgt. Raz Mintz, 19, of Kiryat Motzkin was killed by Palestinian gunmen 5:45 P.M. on Friday at an IDF roadblock at near Ofra, north of Ramallah. More information -------------------------------------------------------------------------------- Date: Oct 28, 2001 Organization: Palestinian Islamic Jihad (PIJ) Attack Type: Shooting Target Type: Bus stop Location: Hadera, Israel Casualties: Killed: 4 Injured: 28 Number of Terrorists Involved: 2 Details: Palestinian gunmen opened fire in the northern Israeli city of Hadera, killing four and wounding 28 others, some critically. More information -------------------------------------------------------------------------------- Date: Oct 28, 2001 Organization: Martyrs of al-Aqsa Attack Type: Shooting Target Type: Military Personnel Location: Kibbutz Metzer, Israel Casualties: Killed: 1 Injured: 0 Number of Terrorists Involved: 2 Details: At around 11:00, Palestinian gunmen opened fire on an Israeli soldier outside the entrance to Kibbutz Metzer, not far from the Green Line which separates the West Bank from "Israel proper." More information -------------------------------------------------------------------------------- Date: Oct 18, 2001 Organization: Fatah Tanzim Attack Type: Shooting Target Type: Vehicle Location: Mar Saba, Judean Desert, West Bank Casualties: Killed: 1 Injured: 2 Number of Terrorists Involved: 2 Details: Lior Kaufman, 30, of Ramat Sharon was killed by shots fired by terrorists at his jeep in the Judean Desert. On Thursday evening, four jeeps making their way out of the Judean Desert were ambushed near the Mar Saba monastery as they headed for the Jerusalem-Jericho highway. Lior Kaufman was shot in the head and died shortly after. Two of his friends were injured. -------------------------------------------------------------------------------- Date: Oct 17, 2001 Organization: Popular Front for the Liberation of Palestine (PFLP) Attack Type: Shooting Target Type: Government Personnel Location: Jerusalem, Israel Casualties: Killed: 1 Injured: 0 Number of Terrorists Involved: 2 Details: Israel’s outgoing Tourism Minister, Rehavam Ze'evi, was killed just outside his Jerusalem Hyatt Hotel room. His wife, returning to their room on the eighth floor of the hotel, discovered him in the hallway just before 7:00 AM. He was taken to Hadassah-University Hospital where he was clinically dead on arrival; urgent treatment failed to revive him, and he was pronounced dead about two hours later, at around 10:00. -------------------------------------------------------------------------------- Date: Oct 7, 2001 Organization: Palestinian Islamic Jihad (PIJ) Attack Type: Suicide Bomb Target Type: Civilian Location: Kibbutz Sheluhot, Israel Casualties: Killed: 1 Injured: 0 Number of Terrorists Involved: 1 Details: Yair Mordechai, 43, of Kibbutz Sheluhot was killed when a Palestinian suicide terrorist detonated a large bomb strapped to his body near the entrance of the kibbutz in the Beit She'an Valley. More information -------------------------------------------------------------------------------- Date: Oct 5, 2001 Organization: Unknown Attack Type: Shooting Target Type: Civilian Location: Avnei Hefetz, Israel Casualties: Killed: 1 Injured: 0 Details: Hananya Ben-Avraham, 46, of Elad was killed by Palestinian terrorists in a machine gun ambush near Avnei Hefetz in central Israel. More information -------------------------------------------------------------------------------- Date: Oct 4, 2001 Organization: Martyrs of al-Aqsa Attack Type: Shooting Target Type: Civilian Location: Afula, Israel Casualties: Killed: 3 Injured: 13 Number of Terrorists Involved: 1 Details: Sgt. Tali Ben-Armon, 19, an off-duty woman soldier from Pardesia, Haim Ben-Ezra, 76, of Givat Hamoreh, and Sergei Freidin, 20, of Afula were killed when a Palestinian terrorist, dressed as an Israeli paratrooper, opened fire on Israeli civilians waiting at the central bus station in Afula. 13 other Israelis were wounded in the attack. Fatah claimed responsibility for the attack. More information -------------------------------------------------------------------------------- Date: Oct 2, 2001 Organization: Hamas (Islamic Resistance Movement) Attack Type: Shooting Target Type: Civilian Location: Alei Sinai, Gaza Strip Casualties: Killed: 2 Injured: 15 Number of Terrorists Involved: 2 Details: Cpl. Liron Harpaz, 19, of Alei Sinai, and Assaf Yitzhaki, 20, of Lod, were killed when a Palestinian terrorist cell infiltrated the northern Gaza District community of Alei Sinai, opening fire on residents and hurling grenades into homes. 15 others were wounded in the attack. More information -------------------------------------------------------------------------------- Date: Sep 24, 2001 Organization: Palestinian Islamic Jihad (PIJ) Attack Type: Shooting Target Type: Civilian Location: Shadmot Mehola, West Bank Casualties: Killed: 1 Injured: 0 Details: Salit Sheetrit, 28, of Kibbutz Sde Eliyahu was killed by gunfire shortly after 6:30 near Shadmot Mehola on the Jordan Valley road. The Islamic Jihad claimed responsibility for the attack. More information -------------------------------------------------------------------------------- Date: Sep 20, 2001 Organization: Martyrs of al-Aqsa Attack Type: Shooting Target Type: Civilian Location: Tekoa, West Bank Casualties: Killed: 1 Injured: 1 Details: Sarit Amrani, 26, of Nokdim, was killed and her husband Shai was seriously wounded in a shooting attack near Tekoa, south of Bethlehem. The couple's three children who were traveling in the vehicle were not injured. Fatah claimed responsibility for the attack. More information -------------------------------------------------------------------------------- Date: Sep 16, 2001 Organization: Unknown Attack Type: Shooting Target Type: Military Personnel Location: near Ramallah, West Bank Casualties: Killed: 1 Injured: 0 Details: Sgt. David Gordukal, 23, of Upper Nazareth, was Odpowiedz Link Zgłoś
Gość: ® TOPOLOGIA IP: *.cm-upc.chello.se 17.04.02, 20:17 2.6. Analytic Topologies Definition 2.6.1. A framed topology on A is called subnormal if for any object X and any non-isomorphic open embedding v: V --> (X) of locales there is a non- initial map t: T --> X such that (t): (T) ® (X) is disjoint with v. Example 2.6.1.1. (a) The framed topologies discussed in (2.5.2.1) are subnormal. (b) All the metric topologies given in [Luo 1995a, Example (2.2.1) - (2.2.3)] may be viewed naturally as subnormal framed topologies. Proposition 2.6.2. A framed topology is subnormal iff any unipotent cover consisting of open effective subobjects is an open effective cover. Proof. First suppose is subnormal. Given a unipotent cover {ui: Ui --> X} consisting of open effective monos. Let v: V --> (X) be the join of {(Ui)}. We have to prove that {ui: Ui --> X} is an open effective cover, i.e. V = (X). We prove it by contradiction. Assume that V is a proper sublocale of (X). Then by (2.6.1) there is a non-initial map t: T --> X such that (t): (T) --> (X) is disjoint with v. Then t is disjoint with each ui by (2.5.4.a). But this is impossible as by assumption {ui} is a unipotent cover. Thus V = (X), i.e. {ui} is an open effective cover on X. Conversely, assume the condition is satisfied. Suppose v: V --> (X) is a non- isomorphic open embedding of locales, which is a join of open effective sublocales (vi): (Vi) --> (X) by (2.5.2.b). Then {vi} is not unipotent by assumption. So we can find a non-initial map t: T --> X which is disjoint with each vi. By (2.5.4.a) (t) is disjoint with the join v of (vi). This shows that is subnormal by definition (2.6.1). Proposition 2.6.3. (a) A framed topology is subnormal iff every open sieve is normal. (b) The open divisor D() of a subnormal framed topology is subnormal. Proof. (a) First suppose is subnormal. Consider an open sieve U on an object X, which is the pullback of an open embedding v: V --> (X) of locales (i.e., a map s is in U iff (s) factors through v). To see that U is normal we have to prove that if t: T --> X is a map dominated by U, then t is in U, i.e. (t) factors through v. Assume that this is not the case. Then (t)-1(V) is a proper open sublocale of (T). Since is normal we can find a non-initial map s: S --> T such that (s) is disjoint with (t)-1(V). Thus (t°s) is disjoint with V. Hence ts is disjoint with U. But this contradicts the fact that t is dominated by U. This shows that U is normal. Conversely assume that any open sieve is normal. Suppose v: V --> (X) is a non- isomorphic open embedding of locales. The open sieve U determined by V is a proper normal sieve on X. Thus U is not unipotent. So we can find a non-initial map t: T --> X which is disjoint with U. This means in particular that t is disjoint with an open effective cover of V. Thus (t): (T) --> (X) is disjoint with v by (2.5.4.a). (b) Suppose is subnormal and u: U --> X is an open effective mono, then u generates an open effective sieve, which is normal by (a). Thus u is normal. We now show that a subnormal framed topology is completely determined by the subnormal divisor of open effective monos. Proposition 2.6.4. (a) Suppose D is a subnormal divisor on A. Then the functor D generated by D is a subnormal framed topology on A. (b) A subnormal framed topology is equivalent to the subnormal framed topology D(). Proof. (a) We already know from (2.4.2) that D is a functor from A to the category of locales and (X) = 0 iff X is initial; each D-sieve on X may be viewed naturally as an open sublocale of (X). Since any D-mono u: U --> X is normal, a map t: T --> X factors through u iff it is dominated by u, and the later is equivalent to that (t) factors through (u). Also one can show easily that (u): (U) --> (X) is an open embedding of locales. Hence u and (u) is open effective for . By (2.4.1) any D-sieve is generated by a set of D-monos U = {ui: Ui --> X}, thus any open sublocale of (X) is a join of open effective sublocales. This shows that is a framed topology, which is subnormal by (2.6.3.a). (b) Suppose is a subnormal framed topology. The open divisor D() of is subnormal by (2.6.3.b), and open sieves coincide with D()-sieves. We obtain a mapping from (X) to D()(X), which is a natural isomorphism. Corollary 2.6.5. (a) A subnormal framed topology is spatial iff for any non- initial object X the locale (X) has a point. (b) If A is locally atomic then any subnormal framed topology on A is spatial. Proof. These follow from (2.4.6) in view of (2.6.4). Definition 2.6.6. (a) If A has pullbacks the framed topology N generated by the normal divisor N of normal monos is called the normal topology. (b) If A is an extensive category the framed topology E generated by the extensive divisor E of direct monos is called the extensive topology. (c) If A is an analytic category the framed topology A generated by the analytic divisor A of analytic monos is called the analytic topology. Clearly the normal topology is the finest subnormal framed topology on a category A with pullbacks. If A is a coflat disjunctable analytic category (e.g. a topos) then any normal mono is analytic, thus the normal and analytic topologies are the same in this case. On the other hand, if A is an analytic category in which any strong mono is an intersection of direct monos (e.g. the category of Stone spaces), then analytic category reduces to extensive topology. Some special cases of extensive topologies have been studied by several authors (see, for instance, Barr and Pare [1980] and Diers [1986]). We will study the main properties of these canonical topologies in Chapter 3. Definition 2.6.7. Suppose A is an analytic category. (a) A divisor is called subanalytic if it consists of analytic monos. (b) A framed (or metric) topology on A is called subanalytic if it is generated by a subanalytic divisor. Definition 2.6.8. (a) We say a framed topology is strict if the Grothendieck topology T() defined by open effective covers is subcanonical (i.e., any representable presheaf of sets is a sheaf) (see (2.5.7)). (b) An analytic category is called strict if its analytic topology is strict. In practice most of the natural framed topologies are subanalytic. The general rule is that if a natural analytic category is not strict (i.e. its analytic topology is not strict), then it carries another natural strict subanalytic framed topology which is more useful than the analytic topology. Example 2.6.8.1. (a) The analytic topologies of the categories of topological spaces, locales, or coherent spaces are not strict, yet each of these categories carries a natural strict subanalytic topology defined by the inclusion functor to the category of locales. (b) The analytic topologies of the categories of Hausdorff spaces, affine schemes, or Stone spaces are strict. Odpowiedz Link Zgłoś
Gość: nonSens TOPOLOGIA NONSENSU IP: *.cm-upc.chello.se 18.04.02, 15:36 Gość portalu: ® napisał(a): ) ) 2.6. Analytic Topologies ) ) Definition 2.6.1. A framed topology on A is called subnormal if for any object ) ) X and Ja, ważam za haniraboebne _aPRZYJAtwo_FaCNNcet z owskiej strony brusem na glowie Glos somCzy ! CZY ZNAC KTszantazowanyDA MARK PFER OS ZYBush nie jest ? any non-iWOTTCIOLrYLKOASOWE! JA-Okupklamie-klamie-** Rozmowa z polGELATI_czzy _przezChrsadzz eścFEonI Żyych_Fratdz inkfur - Polterror_jest_karaacy ijanie ##### Apel Forum - ^^^^^_5_aw__bomby_i_terror_ ___afmanbstwo_musi_wiedziec_Za__!!!! oskarza Shra o barbaOriaKauaronna Frzynstwo Dzisiaj , wstydze sie , ze jestem PoletlejWYosANIE_ISOaK eakiem AntyELSKpolski ??? laci ZIEGluRA _TYMCZ_rozsaCOFgldkuacja bai w Bm Prozba do ....Betlejabs..._________ZbeszBazyKoszmalice Narodzenia ARPańskieg AB DOSZCZETNIE- - ARAArogancja kańskiej P !!!PAMIETAJMY__ "_na_ulicy_abhrzeras cijwsza aydokns sKrótka historia kiebo Polszanuje__ w eksplozję na !!DO_wszystkich_tych_co_ eatadzia-albo logika Czy jest konwencja, sla_ze_ IETY__!!!!!!! CO ZROBILI POLŻFATA_KO? A_mialo_byc_tak_amknie__________ ubepieIslr alles ___w_szoku_!!!__terroyelcles tynza? • W_GA!! _"RADOSCIZIE_CHOCIAZ LONCZY ZdiaZI URATIslDNEGamscy_maliOWALI YDÓWACY Fregi IE_LETNIE_JAK_BYCrysci_styna_ którnie złamałIzrycya _SczaC AMJtan j_rozdzielaja_cukOBOierki__!!!!! ArlanaboYDHowie ael AJEO POLej IzrKA eza?_Zycze.. _____He_He_He_wTHE AV IER _"Zynaprawde was lubie Riniedzi _Euow 8888zabitych_8888 ZMIANA NAZWY en 2,oposcic osiedla 06:58:35 Bale_-teorAl-Qaysci"_! _wiecej _takich_zwycRDUJiestw mali$$$$$$ (1) 18-04-200Czy wiecie ze tturmiecystja _rosna_mordujaow_niehrrid __z_wdzi erykcki cznosciABW : "Pa" is a myth To dziwne , ale umslestinefeld: nam nie uciekł • $$$$$$$$ ZYGI MOA PSopALEejcz TYadeN BerCZYKOWlbin Ln ********__10_88888888888888888888888 Wsiadł do autobusu czowiek z... ZyIslamiscidki musza i ... • przyglup administrator... • STEcottydzcLLA • :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: :::::::: 4____4____4____4____4____4____4Koc, olgahanka, , Nie wstoyie sie, Is A : I Shrink RzHewojydzi !!! B Fevsraelier Hits EuroBloody Characterpe Zacz____4____ęłam się wahać czy poprzeCenzura w (Szokujace zdjecia) !!! MARZE O SW BEZ r aw ARna ChawajeABOW ć Integroddac JerZWYWyborczej CIEZY ozo_______________________________________________ ISR4____4____ AEL lime ZYCIEZDIEI MAJA MOgelatik,cMORDHorFałrienszywyalarmOWAC RALNE ację!!!!! • I zy c y e l z ! # - POPRAWIONE Zaginęli w CzeczPRAWO enii o slychac CZY Kolejseni ę ż tinsh ne nagranie bin Ladena Il sraeForces ected tinians into SBooby- Tr Pn Teager Tells Of rific Expece JewiUaleiaKPaleKoleamacjny zhIsLErael - IZRATYNEL ress Service statystyki skonfiskowana bron / arepoPAkojsusp MP: SStadziecięcej bombowy w pociągu PrzybWARlacz sieylricaice w Betm . szty / trupy • Ku ________________________________________________ SSHAI ARAFwojna RON AT-i Dlaczego Zyndle dow? ________________________ wy do protestu w Washaron zyngtonie WYJAaronmud ZD ZA ining Jurejon bomSZAWY osmutn) Definition 2.6.7. Suppose A is an analytic category. ) (a) A divisor is called subanalytic if it consists of analytic monos. ) (b) A framed (or metric) topology on A is called subanalytic if it is generated ) ) by a subanalytic divisor. ) ) Definition 2.6.8. (a) We say a framed topology is strict if the Grothendieck ) topology T() defined by open effective covers is subcanonical (i.e., any ) representable presheaf of sets is a sheaf) (see (2.5.7)). ) (b) An analytic category is called strict if its analytic topology is strict. ) ) In practice most of the natural framed topologies are subanalytic. The general ) rule is that if a natural analytic category is not strict (i.e. its analytic ) topology is not strict), then it carries another natural strict subanalytic ) framed topology which is more useful than the analytic topology. ) ) Example 2.6.8.1. (a) The analytic topologies of the categories of topological ) spaces, locales, or coherent spaces are not strict, yet each of these ) categories carries a natural strict subanalytic topology defined by the ) inclusion functor to the category of locales. ) (b) The analytic topologies of the categories of Hausdorff spaces, affine ) schemes, or Stone spaces are strict. ) If A is a coflat disjunctable analytic category ) (e.g. a topos) then any normal mono is analytic, thus the normal and analytic ) topologies are the y w Bie w-Amen obroniewirtualnejpornawdnonieuryśzimygrafii Forces PTalShOlRAood • Tci w DARelfaścMO DO na manifestacje - zrodla informacji ______________KTOS_TO__COS!!!!!!!!!! UlejeSA Bazdaism With BNAPWDE_TYLKproPAL SA ZWYY KA• Marsyjanie wyslali PUT • I z ę rwey c i l z a ! 523ż y PRCIEZIME Nigdy_nigdy_nigAYzeziIDO dziach DS AYIS ^^^Kzdy_kr Demoja przeciw, wyjazd za _bronic_obywateliaj_musiOM Mnstr acAJ) (b) All the metric topologies given in [Luo 1995a, Example (RCZAZETżhA co jest eAPEL dziachUHKORKIEGO - OD 88 _nie_bylo_takiego_tworu _przed_żydzlesti Informacje Brńs wypkiegoATKI?. owiO) initial map t: ) map t: T --) X which is disjoint with U. This means in particular that t is ) disjoint with an open effective cover of V. Thus (t): (T) --) (X) is disjoin ) t ) with v by (2.5.4.a). ) (b) Suppose is subnormal and u: U --) X is an open effective mono, then u ) generates an open effective sieve, which is normal by (a). Thus u is normal. ) ) We now show that a subnormal framed topology is completely determined by the ) subnormal divisor of open effective monos. ) ) Proposition 2.6.4. (a) Suppose D is a subnormal divisor on A. Then the functor ) D generated by D is a subnnadzieji z ZydoBazylika_! Bl. Wscem hód: r w islamK ZGLUPIAL skim francilakowszkaninem w Dlaczego zydDżerzacjibiezi obrazaja Po? N chcą delegdyjczykówali Kościacj onaliścimbarC zoła kcki • Zboterech Kana dował, bo nie wiedział ? Czy są nieŻEBY ? Tragedia Ar_DZIECIafOr.. winni zginęło myzwycihandluja ckimi niewoKOBRATOWAC ak zamieszany lnicami od amerymilosna ormal framed topology on A. T --) X such that (t): (T) ® (X) is disjoint with v. ) Example 2.6.1.1. (a) The framed topologies discussed in (2.5.2.1) are ) subnormal. agenścGcyjne.. Prośba Co jerest smutortne w dy_p• emm droga radiowa ESKMANAMMAD sygnal w 1967 wynalazl kto Prydowskiczytaczam do panópowiepw ze StaroAWYBińskiej tekst - co wy na to rzenigdyZepYDOWSniokojące wwyropaynskich NARODU KIGCILWALEDY IMOSI ODDADZA ZaDdarmo do IrEX,TNIE aku I 6 LES orphic open embedding v: V --) (X) of locales there is a n ) on- 2.2.1) - (2.2.3)] ) may be viewed naturally as subnormal framed topologies. ) ) Proposition 2.6.2. A framed topology is subnormal iff any unipotent cover ) consisting of open effective subobjects is an open effective cover. ) ) Proof. First suppose is subnormal. Given a unipotent cover {ui: Ui --) X} ) consisting of open effective monos. Let v: V --) (X) be the join of {(Ui)}. ) We ) have to prove that {ui: Ui --) X} is an open effective cover, i.e. V = (X). ) We ) prove it by contradiction. Assume that V is a proper sublocale of (X). Then by ) (2.6.1) there is a non-initial map t: T --) X such that (t): (T) --) (X) ) is ) disjoint with v. Then t is disjoint with each ui by (2.5.4.a). But this is ) impossible as by assumption {ui} is a unipotent cover. Thus V = (X), i.e. {ui} ) is an open effective cover on X. ) Conversely, assume the condition is satisfied. Suppose v: V --) (X) is a non ) - ) isomorphic open embedding of locales, which is a join of open effective ) sublocales (vi): (Vi) --) (X) by (2.5.2.b). Then {vi} is not unipotent by ) assumption. So we can find a non-initial map t: T --) X which is disjoint wi ) th Odpowiedz Link Zgłoś
alef1 Re: TOPOLOGIA NONSENSU 29.04.02, 23:50 Gość portalu: nonSens napisał(a): > Gość portalu: ® napisał(a): > > ) 2.6. Analogietion 2.6.amed topology on A is called subnormal if for any obm za haniraboebne _aPRZYJAtwo_FaCNNcet z owskiej > strbrusem na glowie GlomCzy ! CZY ZNAC KTsowanyDA MARK PFER OS > ZYBush nie jest ? anyTCIOLrYLKOASOWEupklammowa > z > polGELATI_rzezChrseścFEonI Żyyctdz inkfur >Polterror_jest_karaacy > ijanie #####> Apel Forum - ^^^^^_5_aw__boterror_ > ___afmanbstwo_musi_wiedziec_Za__!!!! > oskarShrbaOriaKauarozynstwo Dzisiaj , wstydze sie , ze > jestPoletlejWYosANIE_ISOaK eakiem AntyElski ??? laluRA > _TYMCZ_rozsaCOFgldkuacja bai w Bm ProzBetlaKoszmaNanieg AB > DOZERAAckańsETAJcy_abhrzeras cijwsza aydokns sKróistoria kiebo Polszlozję nystkich_tychatadzia-oginwencja, sla_ze_ > IETY__!!!!!!! > CO ZROFATA_KO? A_mnipieIslr allezoku_!!yeynza? • W_GA!!> _"RADOSCIZIE_CHOCIAZ LONCZY ZdiaZI URATIslDNEGamscy_maliOWALI YDÓWACY Fregi > IE_LETNIE_JAK_BYCrysci_styna_> którnie złamałIzrycya _SczaC AMJtan > j_rozdzielaja_cukOBOierki__!!!!!> ArlanaboYDHowie ael AJEO POLej IzrKA eza? _Zycze> _____He_He_He_wTHE AV IER _"Zynaprawde was > lubie Riniedzi _Euow 8888zabitych_8888 > ZMIANA NAZWY en 2,oposcic osiedla 06:58:35 Bale_-teorAl- Qaysci"_! _wiecej > _takich_zwycRDUJiestw mali$$$$$$ (1) 18-04-200Czy wiecie > ze tturmiecystja _rosna_mordujaow_niehrrid __z_wdzi erykcki cznosciABW : "Pa" i > s > a myth To dziwne , ale umslestinefeld: nam nie uciekł • $$$$$$$$ ZYGI MOA > PSopALEejcz > TYadeN BerCZYKOWlbin Ln > ********__10_88888888888888888888888 Wsiadł do autobusu czowiek z> ZyIslamiscidki musza i ... • przyglupadministrator... •>STEcottydzcLLA • :::::::::::::::::::::::::::::::::::::: ::::::::::::::::::> ::::::> :::::::: 4____4____4____4____4____4____4Koc, olgayie sie> Is A : I Shrink RzHewojydzi !!! B Fevsraelier Hits EuroBloracterpe > Zacz____4____ęłam się wahać czy poprzeCenzura w (Szokujace zdjecia) > !!! MARZE O SW BEZ r aw ARna ChawajeABOW ć Integroddac > JerZWYWyborczej CIEZY > ISR4____4____YCIEZDIEI MMOgelatik,cMORDHorFałrienszywyalarmOWA> RALNE > ację!!zy c y e l z ! # - POPRAginęli w > CzeczPRAWO enii o slychac CZY > Kolejseni ę ż tinsh ne nagranie bin Ladena Il sraeForces > Tr Pn Teager Tells Of rific Expece > JewiUaleiaKPaleKoleamacjny zhIsLErael - IZRATYNEL ress > Service statystyki skonfiskowana bron / arepoPAkojsusp MP: SStadziecięcej bombo > wy > w pociągu > PrzybWARlacz sieylricaice w Betm . szty / trupy • Ku > ________________________________________________ SSHAI ARAFwojna RON AT-i > DlacZyndle dow? ________________________ > wy do protestu w Wan zyngtonie WYJAaronmud ZD ZA ining Jurejon bomSZAWY > osmnanaategory> ) (a) A divisor is callensists of analynos> ) (b) A called subanalytic if it is genera> ed> ) by a subanalytic divisor. > )say a framed topology is strict if the Grothendieck> > ) topology T() defined by open effective covers is subcanonical (i.e., any > ) representable presheaf of sets is a sheaf) (see (2.5.7)). > ) (b) An analytic category is called strict if its analytic topology is strict> ) > ) In practice most of the natural framed topologies topology which is more useful than the analytic topology. > ) > ) topologire the y w Bie w-Amenobroniewirtualnejpornawdnonieuryśzimygrafii > > Forces PTalShOlRAood • Tci w DARelfaścMO DOnifestacje - zrodla info> rmacji > ______________KTOS_TO__COS!!!!!!!!!! UlejeSA Bazdaism With > BNAPWDE_TYLKproPAL SA ZWYY KA• Marsyjayslali PUT • I z ę rwey > c i l z a ! 523ż y PRCIEZIME> Nigdy_nigdy_nigAYzeziIDO dziach DS AYIS ^^^Kzdy_kr> Mnstr acAJ) (b) All the metric topologies given in [Luo 1995a, Example > OD 88 _nie_bylo_takiego_tworu _przed_żydzlesti Informacje Brńs wypkiegoATKI?. > owiO) initial map t: ) map t: T --) X which is disjoint with U. This means in > particular that t is > ) disjoint with an open effective cover of V. Thus (t): (T) --) (X) is disjoin> ) t > ) with v by (2.5.4.a). > ) (b) Suppose is subnormal and u: U --) X is an open effective mono, then u > ) generates an open effective sieve, which is normal by (a). Thus u is normal. > > ) > ) We now show that a subnormal frailakowsmed topology is completely determined by the > ) subnormal divisor of open effective monos> ) > ) Proposition 2.6.4. (a) Suppose D is a subnormal divisor on A. Then the functo> r > ) D generated by D is a subnnadzieji z Zanczkaninem w > Dlaczego ydoBazylika_! > Bl. Wscem hód: r w islZGLUPIAL > frzydDżerzacjibiezi obrazaja Po? N chcą delegdyjczykówali Kościacj są > nieŻEBY ? TragedADZIECIafOwinni zginyzwycihandluja ckimi > niewoKOBRANARODU > KIALEDY IMOSI ODDADZA ZaDdarmo do IrEX,TNIE aku I 6 LES > of locales, which is a join of open effectiublocales (vi): (Vi) --) (X) by (2.5.2.b).ssump.we cana non-initial map t: T --) X which is disjoint wiTOWAC ak zamieszany lnicami od 1) are w dy_p• emm dradiowa ESKMANAMMA> sygnal w 1967 wynalazl kto Prydowskiczytaczam do panópowiepw ze StaroAWYBińskietecto rzenigdyZepYDOWSniokojące wwyropaynskich Odpowiedz Link Zgłoś
Gość: n.t.tk. sl.zb.w. 3=0Oo t.P.L.g.a N.Ns.Ns. IP: *.cm-upc.chello.se 29.04.04, 19:14 t.p.l.g..n.ns.ns. ?? Odpowiedz Link Zgłoś
Gość: gif ________________________________________________ IP: *.cm-upc.chello.se 18.04.02, 02:44 www.jabotinsky.org/ani.gif Odpowiedz Link Zgłoś
Gość: :▄▄▄▄: Linx______________________________________________ IP: *.cm-upc.chello.se 18.04.02, 19:55 JTS ) Libraries & Museums ) Library of the Jewish Theological Seminary ) Recommended Links About JTS Academics Administration Applying to JTS Campus Life Directories Libraries, Museums Research University without Walls Homepage Contact Us Giving to JTS Site Index Site Map Site Search JTS Student Addresses Israel Solidarity Rally on 4/15/02 (4/17/02) $4.5 Million Fellowship Fund for Education & Rabbinical Schools (2/4/02) New Rabbinical School recruitment site (3/21/02) 2002 Summer Session information now online (1/14/02) More JTS news Ongoing Ivry Prozdor Alumni Outreach 3/17-8/2/02 Sonnets of Celebration at JTS Library 4/29/02 Is Liberalism Bad for the Jews? 5/8/02 Sex, Lies, and Much-Told Tales 6/24-7/12/02 3rd Intl. Advanced Seminar in Yiddish Studies Recommended Links Holocaust Resources Jewish Education -------------------------------------------------------------------------------- Jewish Education Table of Contents Youth activities: movements, camps, Israel tour Jewish day schools and supplementary schools Net education Distance education and home schooling Resources for educators BJE's Journals Databases Organizations Educational theory Jewish communities around the world Special education Adult education Virtual Education Libraries Schools of Jewish Education -------------------------------------------------------------------------------- YOUTH ACTIVITIES: MOVEMENTS, CAMPS, ISRAEL TOUR North American Alliance for Jewish Youth http://www.naajewishyouth.org/ National Ramah Commission http://www.campramah.org/ Israel in our Lives http://www.israelives.org/camp/camps.html Full text (PDF) of Israel in Jewish Summer Camps by D. Friedman and D. Zisenwine. The site and organization are a joint project of JESNA: Jewish Education Service of North America and Israel Experience, Inc. Looksmart categories: Jewish summer camps http://www.looksmart.com/eus1/eus53706/eus53720/eus145534/eus62482/eus917309/r? l& Links to websites of Jewish summer camps Summercamps.com http://www.summercamps.com/fs_search.html Listing of contact information on summer camps; search for Jewish in Religion category LAJewishteen.org http://www.lajewishteen.org/mainpage.htm Israel tours sponsored by major Jewish and Zionist youth movements Association of Jewish Youth http://users.anjy.org/orgs/ Links to webpages of major Jewish and Zionist Youth Organizations. British based non-profit Jewish community service. World Zionist Organization - youth movement pages and links http://www.wzo.org.il/politics/youthlinks.html -------------------------------------------------------------------------------- JEWISH DAY SCHOOLS AND SUPPLEMENTARY SCHOOLS Schechter Connector http://www.uscj.org/ssds/index1.html Centralized web site for Solomon Schechter schools Ottawa Modern Jewish School http://www.omjs.ca The Rise of Jewish schools, by Peter Beinart The Atlantic Monthly, October 1999 http://www.theatlantic.com/issues/99oct/9910jewishschools.htm Jewish Secondary School #22 - Kishinev, Republic of Moldova http://kishinev.lk.net/school.html San Diego Orthodox Jewish Community and School Network http://www.sandiegojewish.org/schools.html -------------------------------------------------------------------------------- NET EDUCATION Innovative Education Sites http://faculty.washington.edu/~krumme/education.html Links to websites on a wide variety of educational issues, including distance learning, curriculum development, hypertext-hypermedia, etc. Institute for Learning Technologies http://www.ilt.columbia.edu/ Blue Web'n - a library of blue ribbon learning sites on the web http://www.kn.pacbell.com/wired/bluewebn/ An Educator's Guide to the Internet http://cac.psu.edu/~cgk4/design.html Essay on and resources for the use of the Internet in secondary and college courses. Virtual Architecture's web home http://ccwf.cc.utexas.edu/%7Ejbharris/Virtual-Architecture/ Electronic adaptation of Judy Harris' book Virtual Architecture, on the uses of web education. Educause http://www.educause.edu/ Cutting edge articles on educational technology. Nonprofit association whose mission is to help shape and enable transformational change in higher education through the introduction, use, and management of information resources and technologies in teaching, learning, scholarship, research, and institutional management Eduweb http://www.eduweb.co.uk/index.html Private Eye http://www.the-private-eye.com/ruef/html/home.htm AskEric lesson plans http://www.askeric.org/Virtual/Lessons/ Busy Teachers' web site, K-12 http://www.ceismc.gatech.edu/busyt/toc.html Thinkquest http://www.thinkquest.org/library/ -------------------------------------------------------------------------------- DISTANCE EDUCATION AND HOME SCHOOLING The Education Coalition http://www.tecweb.org/eddevel/eddevframe.html Essays and bibliographies on Distance Education. Non-profit educational organization, created in 1993 to serve the needs of the business and education communities. Distance-Educator http://www.distance-educator.com/ Commercial research and development consulting firm on all aspects of distance learning. Distance Learning on the Net http://www.hoyle.com/distance.htm Commercial consulting firm of Dr. Glenn Hoyle. Useful essays and links to K-12, college and training distance learning web sites. Pedia - the Hellenic educational web server http://www.pedia.gr/links/lin-2-thmia.html Secondary school links, including distance learning sites. World Wide Web Virtual Library: Distance Education http://www.cisnet.com/~cattales/Deducation.html Comprehensive listing of links to sites containing offerings, journals, organizations and essays relating to distance learning. The Open Directory Project http://dmoz.org/Reference/Education/Distance_Learning/Resources/Precollege/ Small selection of links to precollege distance learning resources. Association for Supervision and Curriculum Development http://www.ascd.org/readingroom.html Association for Supervision and Curriculum Development archived journals, including material on distance learning and much more Wested - distance learning resource project http://www.wested.org/tie/dlrn Essays on distance learning. A non-profit research, development and service agency dedicated to improving education and other opportunities for children, youth and adults. TEAMS distance learning http://teams.lacoe.edu/welcome.html -------------------------------------------------------------------------------- RESOURCES FOR EDUCATORS University of Illinois - College of Education - resources http://x.ed.uiuc.edu/EPS/Ed_Resources/index.html McGill University - Jewish Studies program http://www.arts.mcgill.ca/programs/Jewish/30yrs/education.html J. Reimer et al on Jewish education Jewish Education in Ancient Times, by R. Mosely http://www.homeschoolfaq.com/jewish_education.htm taken from online journal of Christian fans of Judaism LTSI - Learning Thinking Styles Inventory http://www1.vmi.edu/IR/ltsi.htm Israel embassy in the United States) Jewish education links http://www.israelemb.org/miami/othedu.htm Israeli education links http://www.jr.co.il/hotsites/i-edu.htm The Pedagogic Center - Jewish Agency for Israel Department of Education http://www.jajz-ed.org.il/index1.html The Pedagogic Resource Centre for Jewish Education - Hebrew University Center for Jewish Education in the Diaspora http://sites.huji.ac.il/melton/library.html Dissertations in Jewish Education Hebrew University Center for Jewish Education in the Di Odpowiedz Link Zgłoś
Gość: :▄▄▄▄: Re: Linx______________________________________________ IP: *.cm-upc.chello.se 18.04.02, 20:36 jewishhistory.huji.ac.il/ icj.huji.ac.il/ jewishhistory.huji.ac.il/links/Archaeology.htm shamash.org/trb/judaism.html Odpowiedz Link Zgłoś
Gość: :▄▄▄▄: poprawka IP: *.cm-upc.chello.se 18.04.02, 20:52 Gość portalu: :▄▄▄▄: napisał(a): www.jewishhistory.huji.ac.il/ www.icj.huji.ac.il/ www.jewishhistory.huji.ac.il/links/Archaeology.htm www.shamash.org/trb/judaism.html Odpowiedz Link Zgłoś
Gość: :▄▄▄▄: jeszcze raz IP: *.cm-upc.chello.se 18.04.02, 20:54 Gość portalu: :▄▄▄▄: napisał(a): > Gość portalu: :▄▄▄▄: napisał(a): > www.jewishhistory.huji.ac.il/ www.icj.huji.ac.il/ www.jewishhistory.huji.ac.il/links/Archaeology.htm www.shamash.org/trb/judaism.html > Odpowiedz Link Zgłoś
Gość: █▄▄▄▄█ Najwiekszy terrorysta swiata :Marwan Barghouti IP: *.cm-upc.chello.se 19.04.02, 01:09 www.tzemach.org/fyi/docs/beres/april16-02.htm The Trial of Marwan Barghouti 16 April 2002 When the victorious allied powers established a military tribunal at Nuremberg on August 8, 1945, they reaffirmed an ancient principle of law: Nullum crimen sine poena, "No crime without a punishment." In 1946, this reaffirmation was codified as Principle I of the legally binding Nuremberg Principles: "Any person who commits an act which constitutes a crime under international law is responsible therefore and liable to punishment." These Nuremberg Principles, later formulated by the United Nations International Law Commission in 1950, stipulate: "Offenses against the peace and security of mankind...are crimes under international law, for which all responsible individuals shall be punished." Terrorism is a serious offense against the "peace and security of mankind." Marwan Barghouti, leader of Yassir Arafat's Fatah and the man openly responsible for dozens of suicide bomb attacks on Israeli civilians, is one of the world's most wanted terrorists. Arrested by Israeli special forces on April 15, 2002, during Prime Minister Sharon's essential retaliatory military operations against Palestinian terrorist infrastructures, Barghouti will be put on trial for his multiple crimes, including crimes against humanity. This judicial action by Israel will represent indispensable support for our decentralized system of international law, a system that always relies for its success upon the willingness of individual states to use their own courts for prosecution of international criminals. Barghouti heads the Al Aqsa Martyrs Brigade, the Palestinian militia that plans and celebrates the maiming, burning and murder of Jewish men, women and children in schools, buses and restaurants. By the standards of contemporary international law, terrorists are known as hostes humani generis, "common enemies of humankind." In the fashion of pirates, who were to be hanged by the first authorities into whose hands they fell, terrorists are international outlaws who come within the scope of "universal jurisdiction." The fact that Barghouti's terrible crimes had been directed specifically against Israel removes any doubts about that country's particular jurisdiction in this matter. Punishment of violent crime must always lie at the very heart of justice. In our decentralized system of world law, which still lacks a permanently functioning international criminal court, prosecution by individual states is often the only available path to punishment. In the absence of Israel's essential operations against Palestinian terrorism, outlaws like Barghouti would remain altogether free to commit further atrocities. Immune to the proper expectations of extradition and prosecution (the Palestinian Authority would hardly agree to comply with these expectations of international law), Barghouti would proceed with the organization of Palestinian children into cadres of "martyrs." Barghouti naturally thinks of himself as a "freedom fighter," not a terrorist. But even if his objective of Palestinian self-determination could be accepted under authoritative international law (and this is highly problematic), the means used in his use of violence are indisputably unlawful. The Law of Armed Conflict, which applies to insurgents as well as to uniformed armies, makes it clear that the ends can never justify the means. A cause, even if legitimate, can never excuse the use of violence against the innocent. International law is not a suicide pact. The State of Israel, in the fashion of every state in world politics, has not only the right but the obligation to protect its citizens' most basic human right — the right to remain alive. In this connection, the Israeli military operation that led to Barghouti's arrest is supported not only by the post-attack right of self-defense codified at Article 51 of the UN Charter, but also by the customary right of anticipatory self-defense. Israel's actions in the Barghouti case are fully supported by the law of the United States. For our own country, the Nuremberg obligations to bring terrorists to trial are doubly binding. This is because these obligations represent not only rules under international law, but also the obligations of a Higher Law embedded in the American philosophic tradition. All international criminal law is part of the law of the United States, an incorporation expressed at Article VI of the US Constitution and by associated Supreme Court decisions. United States federal law confers jurisdiction "to try any person who, by the laws of war, is subject to trial by a military tribunal...." (10 U.S.C. Sec. 818, 1994). Additionally, federal law grants jurisdiction to the federal district courts for all offenses against the laws of the United States (18 U.S.C. Sec. 3231, 1994). Since the United States was founded, our country has reserved the right to enforce international law within its own courts. At Article 1, Sec. 8, Cl 10, the Constitution confers on Congress the power "to define and punish piracies and felonies committed on the high seas, and offenses against the law of nations." Israel's planned prosecution of Palestinian terrorist Marwan Barghouti is fully supported by both international law and the law of the United States of America. Representing the best available option to support civilizational remedies against barbarism, it is a jurisprudential effort that now warrants worldwide support. It should also be recalled that Barghouti is a sworn enemy of the United States, a criminal who aided Saddam Hussein in his rape of Kuwait and who is closely allied with the medieval forces behind September 11th. On September 12th, when Israeli flags were lowered to half staff, Barghouti celebrated our national misfortune with other Fatah leaders. -------------------------------------------------------------------------------- Louis Rene Beres (Ph.D., Princeton, 1971), Professor, Department of Political Science, Purdue University, lectures and publishes widely on Israeli strategic matters. His work is well-known to Israel's military and academic communities. He is also the academic adviser at the Freeman Center for Strategic Studies, a Houston-based research facility and political action group. Odpowiedz Link Zgłoś
Gość: █▄▄▄▄█ Khaled Ibrahim Tapish szef Hamasu aresztowany! IP: *.cm-upc.chello.se 19.04.02, 20:59 13:00) Commandos capture Hamas military chief in Bethlehem IDF commandos and reserve soldiers captured a commander of Hamas's military wing in Bethlehem today. Khaled Ibrahim Tapish was arrested along with another Hamas operative during the course of IDF anti-terror operations in the West Bank city located just south of Jerusalem. The two Hamas men were handed over to the Shin Bet internal security agency for interrogation, Army Radio reported. Odpowiedz Link Zgłoś
Gość: Λ V ............................The return of Vichyism IP: *.cm-upc.chello.se 19.04.02, 23:45 http://www.jpost.com/Editions/2002/04/19/News/News.47279.html EYES ABROAD: The return of Vichyism By Bret Stephens READING ABOUT the recent upsurge in anti-Semitic attacks and anti-Israel feeling in Europe, two points are clear. The first point is that the perpetrators of the attacks are mainly Arab. In Montpellier, France, three Moroccans confessed to throwing Molotov cocktails at a synagogue. In Antwerp, Belgium, 14 Muslims are under arrest for smashing car and store windows in the city's diamond district. In Berlin, Germany, the men who set upon a Lubavitcher are described in a police report as Suedlaendisch - southlanders. The second point is that those protesting Israel are mainly from the Left. The same people who marched in last year's massive antiglobalization protests have now returned to denounce Ariel Sharon. The same Nobel committee that in 1994 awarded the peace prize to Yasser Arafat now want to take it away from Shimon Peres. In Italy, pro-Palestinian marches are the handiwork of social democrats, Greens, Communists and trade-union leaders. In Britain, the ultra-left New Statesman devoted an issue to the "Kosher Conspiracy," its cover an illustration of a Star of David piercing the heart of the Union Jack. None of this should come as a surprise. And yet it would be a mistake to argue that what's going on here is the return of the old anti-Semitism, as if it were a congenital disease whose symptoms had merely gone into remission these past 50-odd years. Were that the case, one would expect a rise in anti-Semitic attacks carried out by Europeans themselves. But the violence today is essentially a Middle Eastern phenomenon, imported into the Continent by a burgeoning Muslim population. Most Europeans - most West Europeans, at any rate - are appalled by it. Then too, to say that the anti-Israel left has become anti-Semitic both overstates the case and misses the point. Overstates because, even while there's a hard core of Israel-haters who really are anti-Semitic - France's Robert Faurisson comes to mind - many more are simply well-wishers of what they see as the legitimate Palestinian struggle for self- determination within the West Bank and Gaza Strip. And it misses the point because opposing IsraelÕs policies in the territories (or just plain opposing Israel) is just one plank in a much broader political and cultural agenda covering everything from global warming to free trade to labor policy. In this, anti-Semitism is never a premise, and only rarely a conclusion, whereas for genuine anti-Semites the malevolence of Jews is always the premise. SOMETHING ELSE, then, is at work here. Call it the politics of capitulation, or the triumph of Vichyism. For those who follow European politics closely, and especially its foreign policy, two things especially stand out: the loftiness of the rhetoric, and the timidity of the deed."The hour of Europe has come!" said LuxembourgÕs foreign minister Jacques Poos in 1991, following a diplomatic mission to keep Serbia and Croatia from going to war. The Balkan wars were supposed to provide the occasion for Europe to take the place of the Soviet Union as the second main pole of power in the world, maintaining order within its sphere of influence. Instead, the EU sloughed off responsibility, first to the feckless UN, then to the United States. The result was Srebenica, carried out with the docile compliance of Dutch UN peacekeepers. Part of the reason why Europe so often fails to act is structural: European states speak collectively, but act independently. Yet the structure is not an accident; it reflects a mutual convenience. Europe wants to put forth a view but it does not want to incur the costs - political, financial but most of all moral - of imposing its will. Take the vote earlier this month by the basically powerless European Parliament to sanction Israel - and the decision by the powerful European Council to do nothing of the sort. Given the near unanimous European hysteria over alleged IDF massacres of Palestinians, there was something almost craven about the Council's decision: Countries that commit the kind of deeds of which the Israelis are accused should be sanctioned. Yet for the EU, posturing was enough. It offered just the right combination of self- congratulation, "responsiveness" to the street protestors, and appeasement of the Arabs, both within Europe and without. At the same time, it required nothing concrete of the European member states. It was a costless capitulation. Indeed, capitulation has long been the hallmark of European governance. If French, German and Italian unions routinely go on strike, it's because they have learned that the government will likely give in to their demands. Ditto for European farmers, who command nearly 50% of the EU's total operating budget because EU governments live in fear of rural unrest. But this is as nothing next to Europe's capitulations to the Arab world over the past three decades. Beginning in September 1970, when Europe agreed to the release of Palestinian terrorists in exchange for the release of hijacked airline passengers, Europe has consistently pursued a policy of accommodation with terrorists, from the PLO to the PKK to the Tamil Tigers. In France, police routinely turn a blind eye to looting rampages in Arab neighborhoods. And cases of assault by Arabs against Jews were - until they became a political scandal this month - met with indifference by police authorities. Given this, it's no surprise that Israel's policy of standing up to terrorism in the West Bank should elicit such hostility among EuropeÕs governing class, for it threatens to arouse their own Arab street in ways beyond their capacity to appease. But I think it goes deeper than this. In Europe, the habits of capitulation are not merely a cowardly reflex and a source of shame, but a philosophical conceit. Europe is proud of its powerlessness, and sees it as proof of superior virtue. Partly, I think, this reflects a Christian inheritance, seen today in the pacifism of EuropeÕs Green parties. Partly, too, it is the product of EuropeÕs historical decline. A continent that for 400 years directed world events cannot accept accept its sudden political irrelevance save by treating the matter as an inevitability from which it has derived great wisdom. Thus, for example, the collapse of EuropeÕs empires was transformed into the positive good of "decolonization." (That decolonization hasn't exactly done good by, say, Algerians or Sierra Leoneans, doesn't trouble the European conscience. What matters is to hold to the belief that with the loss of power came a gain in virtue.) More basic to this equation, however, is the memory of the Holocaust. Typically among Jews, the prevalence of anti-Zionism in Europe is ascribed to a latent anti-Semitism, not to mention a desire to overcome a guilty conscience by painting Israeli tactics as Nazi. This may be accurate in some instances, but I would argue that the opposite is generally closer to the truth. Hatred of Israel comes from too close an identification with the victims of the Holocaust, with too great a fetish for powerlessness. Because Israel stands for Jewish power, it was bound to lose favor to those who could present themselves as the new victims. And Palestinians have been very adept at this. What Europe wants, then, is not to harm Jews. It wants to save them, and thereby avail itself of the only means of redeeming itself. But for that to happen, Israel must again become as weak and vulnerable as it was before 1967. Back then, recall, Israel was very popular among Europeans. IT MAY SEEM strange that roughly the same people for whom consciousness of th Odpowiedz Link Zgłoś
Gość: Λ V ................The return of Vichyism 2 IP: *.cm-upc.chello.se 19.04.02, 23:51 What Europe wants, then, is not to harm Jews. It wants to save them, and thereby avail itself of the only means of redeeming itself. But for that to happen, Israel must again become as weak and vulnerable as it was before 1967. Back then, recall, Israel was very popular among Europeans. IT MAY SEEM strange that roughly the same people for whom consciousness of the Holocaust remains the great informing value would seek to castigate Israel at every turn and appease those who would destroy it. But this merely points out the incoherence of European policy, both toward Israel as well as the rest of the world. For the lesson that much of Europe - especially the European Left - has taken away from the Second World War is not that power must be exercised sensibly and morally, but that power must not really be exercised at all. Hence the politics of capitulation I described above. Yet the essence of Vichy was not capitulation, even if capitulation is what led to Vichy's creation. The essence of Vichy was its complicity in evil. Vichy may have started out as a helpless regime that had no choice but to go along with Berlin's dictates. In fact, as we now know too well, Vichy soon became a willing partner in Nazi crimes. Today, Europe follows the path of accommodation to terrorism, to the anti- Israel fashions of the Left, to the demands of its Arab street. It does so out of convenience and cowardice, but also because it believes that there is virtue in weakness and retreat. Yet a Europe that has voluntarily renounced the exercise of power and given in to the demands of its "street" is a complicitous Europe. This may be different from an anti-Semitic Europe, but it is no less disgraceful. Odpowiedz Link Zgłoś
Gość: פשמ .................Twarze ofiar terroru IP: *.cm-upc.chello.se 20.04.02, 23:58 -------------------------------------------------------------------------------- www.walk4israel.com/index.cfm?fuseaction=Victims www.walk4israel.com/index.cfm?CurrentPage=2&fuseaction=Victims& www.walk4israel.com/index.cfm?CurrentPage=3&fuseaction=Victims& www.walk4israel.com/index.cfm?CurrentPage=4&fuseaction=Victims& www.walk4israel.com/index.cfm?CurrentPage=5&fuseaction=Victims& www.walk4israel.com/index.cfm?CurrentPage=6&fuseaction=Victims& www.walk4israel.com/index.cfm?CurrentPage=7&fuseaction=Victims& www.walk4israel.com/index.cfm?CurrentPage=8&fuseaction=Victims& www.walk4israel.com/index.cfm?CurrentPage=9&fuseaction=Victims& ________________________________________________________________________ www.walk4israel.com/images/faces/face/0000000000hang2.jpg April 12, 2002 - Apr 12, 2002 - Chai Siang Yang, 32, a foreign worker from China, was killed by a woman suicide bomber who detonated a powerful charge at a bus stop on Jaffa road next to the entrance to Jerusalem's Mahane Yehuda open- air market. Another 104 people were injured in the blast, among them nine Arabs. The Al-Aqsa Martyrs' Brigades claimed responsibility for the attack. Chai Siang Yang came to Israel four months ago from Putian in Fujian Province in southeastern China. Yang worked as a builder for the Aronson Company which constructs buildings in Jerusalem. Monthly, he would send money back to his family in China. Yang lived in an apartment in the Pisgat Zeev neighborhood of Jerusalem with other workers from China. He and his friends were accustomed to shopping in Mahane Yehuda on Friday afternoons, to take advantage of the low pre-Sabbath prices. "They told us that Yang was working far from the war area," said Yang's older brother. Chai Siang Yang leaves behind a wife and two daughters 8 and 2. ________________________________________________________________ www.walk4israel.com/images/faces/face/00000000ORLY.jpg March 31, 2002 - Mar 31, 2002 - Orly Ofir, 16, of Haifa was one of 14 people killed in a suicide bombing in Haifa, in the Matza restaurant of the gas station near the Grand Canyon shopping mall. Just after 2:30 PM on Sunday afternoon, during the Passover holiday, the terrorist entered the popular Matza restaurant in the Neve Sha'anan district near the Grand Canyon mall. The explosion tore the roof off the one-story building, and blew out the windows, instantly killing 14 people, and leaving horrific scenes of people on fire, and people with lost limbs. Over 40 people were injured. Orly Ofir was having lunch with her mother and two sisters at the Matza restaurant when the blast occurred. Her sister Roni was lightly injured. Although Orly spoke to them in the ambulance, she died of her wounds shortly after arriving at the hospital. Orly was a high school student, and played on the Maccabi Haifa girls' soccer team. Yesterday the head of the team, Shuki Frankel, described Orly as an outstanding player. Her friends described her as a very special girl, with a lively, cheerful personality. Orly Ofir was buried in Haifa. She is survived by her parents, Yossi and Shuli, and her sisters Roni and Ilanit. ............................... ................................ ................................ Odpowiedz Link Zgłoś
Gość: Λ V Zwyciestwo nad terrorem...... IP: *.cm-upc.chello.se 22.04.02, 16:57 Israel’s Victory over Palestinians Ripples Widely DEBKAfile Political-Military Analysis 20 April: By any military standards, the large-scale offensive Israel launched on March 29 against seven Palestinian cities and their satellite villages and camps, is a victory and a resounding Palestinian defeat. All the Palestinian groups, including Yasser Arafat’s Fatah al Aqsa Martyrs Brigades, tried desperately to keep the suicide offensive alive – and still do. But the crippling of their terror machine soon showed dramatic dividends: In three weeks, their suicide offensive tapered off conspicuously – down to four, in which 28 Israelis died – mostly bunched together at the tail end of the dread Passover offensive that left 52 Israelis dead in seven days - and triggered the massive Israeli assault. The operation owes its success to four men: US President George W. Bush, Israeli prime minister Ariel Sharon, Israeli chief of staff Lt.-Gen Shaul Mofaz and his deputy and designated successor, Maj.-Gen Moshe Yaalon. Credit for the Palestinian defeat belongs to two individuals and one international organization: Palestinian leader Yasser Arafat and his two leading sponsors, Saudi Crown Prince Abdullah Bin Abdulaziz and the European Union, notably its foreign affairs executive, Javier Solana, who chose to anchor Europe’s Middle East policy on Arafat and his Palestinian Authority. Both encouraged Arafat to believe he would come out on top in his confrontation with the Israelis. He therefore toughed it out with Israel and the Americans – and lost. No one stopped Israel’s armed forces from going ahead and crushing Palestinian terrorist strongholds the length and breadth of the West Bank. Although, Gaza Strip Palestinian institutions of government and security were left intact, no one today questions the completeness of Israel’s success, to the extent that Washington, Jordan, Israel itself and to some extent, Egypt, have taken the military achievement and turned it into a fulcrum to advance their plans for a new Middle East. One caveat and two points are important to note: 1. Israel’s war on terror is not yet over. The Palestinians have not conceded defeat and will keep on trying their suicide tactics, however diminished their capabilities. 2. The effect and long-term consequences of this Israel victory against the Palestinians may be compared to those of its 1948 War of Independence and 1982 Lebanon War, both head-on military clashes with Palestinians. 3. The Battle of Jenin was the decider of this round, as DEBKAfile maintained at the fiercest moment of combat. Had Israel broken off the engagement – or even retreated – the offensive a a whole would have crumbled and Israel faced defeat. Some parties have labeled this heroic battle – in which both sides fought valiantly – a massacre, and often-tried stratagem for transforming an Arab battlefield defeat into a diplomatic victory - as students of past Israel- Palestinian and Israel-Arab conflicts will quickly recognize. While this ruse has often worked in the past, the chances of the truth outing this time are good, thanks to the United States and its president throwing their wholehearted support behind the Israeli government and its stand. The White House came to appreciate why Arafat needs to be locked up in his Ramallah compound and ended up applauding the outcome of the Jenin battle. DEBKAfile’s Washington sources report that, for the present, the Bush administration has determined not to let Israel be robbed of the fruits of this victory, but rather to make it a stepping stone for Washington’s next Middle East moves. Whatever the ups and downs in the relationship – and the recriminations heard from time to time – the American people and the Bush government’s backing for Israel and the Sharon government’s objectives is a fact of life to a degree never enjoyed by any previous Israeli government. There is nothing sentimental about this support. It is predicated on Bush’s fundamental campaign against world terror. The US president has affirmed outright - in deeds and not just words - that Yasser Arafat is an integral part of global terror. This is a historic first that Bush could not duck away from without cutting the moral and ideological ground from under his global war on terror.Condoleezza Rice put the problem succinctly when she said Arafat could not send suicides killers while posing as a man of peace. After finishing with Arafat, Bush means to start on the Arab leaders who espouse the use of suicides for what the White House has come to call homicidal attacks. He has put Arab rulers, who prefer the term martyrs, on notice to stop glorifying and funding this form of terrorism. These developments have set the following trends in motion: 1. Up until Operation Defensive Shield, Arab rulers were wont to use the Palestinian problem as a standard pretext for their refusal to cultivate normal relations with Israel. By branding Arafat a terrorist, Washington has stripped this argument away and forced them to confront the hard choice it posed friends and allies after September 11: Either join America’s all-inclusive campaign against terror or support the other side. 2. Torn by this dilemma and the mounting pro-Islamic, pro-Palestinian pressure at home, the Saudis, like other Arab leaders, are bidding for third-party help against Washington’s demands. Understanding that the White House, by its backing for Ariel Sharon, had dealt a death blow to his peace initiative and foreign policy, Crown Prince Abdullah sent his foreign minister Saud al-Faisal to Moscow on Sunday, April 18, for urgent talks with President Vladimir Putin. Abdullah hoped for some good news before he visits the Bush ranch in Crawford, Texas on April 24. DEBKAfile’s Moscow and Gulf sources report that Putin was surprised to hear al Faisal explaining bluntly and agitatedly that the Americans were pushing Riyadh into irrational and radical positions regarding their campaign against terror, so undoing the close affinity binding them as allies for decades. What the Saudis were therefore seeking was an ally or allies to offset American pressure. They could either turn to Russia or to the Iran-Iraq axis. The Saudi foreign minister said his government preferred Moscow and offered to coordinate its oil policies with the Kremlin and buy Russian arms. Our sources say Putin was not over-impressed by the Saudi minister’s plea. The Putin-Bush political, military and economic pact generated by America’s global war on terror stands out as the most robust feature bar none against the current diplomatic landscape. Al Faisal did not stand a chance of driving a wedge between the two world leaders. The Russian president also knew that the Saudi minister’s did not exactly come with clean hands; Riyadh’s pact with Baghdad and Tehran was no longer an option but an accomplished fact. (Our intelligence newsletter, DEBKA-Net-Weekly, exposed this pact last February.) It is therefore not surprising that Saud al Faisal came away from Moscow empty- handed. 3. A third world power, China, is bent on capitalizing on these shifting trends. President Jiang Zemin and prime minister Zhu Rongji, both of whom are near the end of their terms in office, are making the rounds of Arab and Gulf Emirate capitals and Iran. Posing as the only power siding with the Arab-Muslim camp, the Chinese leaders are offering largesse in the form of military assistance, including Chinese arms, and cooperation in oil strategy. DEBKAfile ’s sources report that China is buying up shares in oilfields and oil resources, to fill in the projected sh Odpowiedz Link Zgłoś
Gość: Λ V Re: Zwyciestwo nad terrorem......2 IP: *.cm-upc.chello.se 22.04.02, 16:58 3. A third world power, China, is bent on capitalizing on these shifting trends. President Jiang Zemin and prime minister Zhu Rongji, both of whom are near the end of their terms in office, are making the rounds of Arab and Gulf Emirate capitals and Iran. Posing as the only power siding with the Arab-Muslim camp, the Chinese leaders are offering largesse in the form of military assistance, including Chinese arms, and cooperation in oil strategy. DEBKAfile ’s sources report that China is buying up shares in oilfields and oil resources, to fill in the projected shortfall between its own oil production and the requirements of its burgeoning economic development. In three to five years’ time, China will be supplying no more than two thirds of its energy consumption from home production. To raise the billions for buying stakes in foreign fields and paying for new pipeline and maritime transport routes, Beijing hopes to sell large quantities of military hardware to Arab states and Iran. Beijing’s new policy turn will have a cooling effect on its relations with Washington relations, as well as with Israel. ________________________________________ Contd. from opp. col. This he hopes to achieve by stirring up increasingly violent popular riots in Arab cities in unison with a fresh wave of suicide and terrorist attacks against Israel, which he is hatching even now. When he refers to himself, it is no longer as Palestinian president, but as the pre-eminent pan-Arab leader. He dwells at length on the growing manifestation of martyrs and suicides in Arab lands, holding up as an example the Egyptian who was killed Friday, April 19, when he tried to infiltrate Israel from Sinai, and the Egyptian woman caught Saturday, April 20 in Taba, attempting to smuggle explosive substances into Israel. In Arafat’s eyes, both were “martyrs of the Arab nation” – and path- blazers. Arafat pins his highest hopes on Saddam Hussein, declaring that at the peak of popular unrest in the Arab states and the fresh anti-Israel suicide cycle, Iraq choose the moment to throw its might against Israel and Jordan. An American military offensive against Baghdad will make no difference; Arafat has no doubt that the offensive will fail and the Iraqi armed forces will be free in no time to loose deadly missiles attacks against Jordan and Israel. Odpowiedz Link Zgłoś
Gość: פםקזחש Voice of Israel IP: *.cm-upc.chello.se 23.04.02, 01:10 www.wrn.org/audio/kol_eng1_usa.ram Odpowiedz Link Zgłoś
Gość: |||||||| Re: Voice of Israel IP: *.cm-upc.chello.se 15.06.02, 16:39 aoo.freeservers.com/cgi-bin/i/images/aiz.gif Odpowiedz Link Zgłoś
pyza3 Re: Voice of Israel 15.06.02, 17:56 15.06.2002 "...po ten kwiat, po ten kwiat czerwony..." "Czerwone maki na Monte Cassino...czerwone są, bo polską piły krew" dymy nad Birkenau NIGDY WIĘCEJ niech nas Bóg ma w swojej opiece. Odpowiedz Link Zgłoś
Gość: żurek Linx Prasa Polska IP: *.cm-upc.chello.se 23.04.02, 23:34 www.prasa.media.pl/katalog02.htm www.prasa.media.pl/katalog19.htm Angora przegląd - antologia prasy polskiej (tygodnik) Bez Dogmatu kwartalnik kulturalno-polityczny Fakty Gazeta Bankowa tygodnik finansowo-gospodarczy Gazeta Polska tygodnik prawicowy La Bestia pismo Ruchu Społeczeństwa Alternatywnego z Gdańska Lewą Nogą kwartalnik polityczno-artystyczny Mać Pariadka Anarchistyczny Magazyn Autorów wydawany w Sopocie, Najwyższy Czas pismo konserwatywno liberalne Nasza Polska tygodnik społeczno - polityczny NIE tygodnik Jerzego Urbana Niedziela tygodnik katolicki Nowa Wieś miesięcznik dla rodziny na wsi i w małym miasteczku Nowy Tygodnik Popularny ogólnopolskie pismo ruchu związkowego Odra miesięcznik literacki, miesięcznik wydawany przez Ośrodek Kultury i Sztuki we Wrocławiu Pełnym Głosem pismo fundacji kobiecej "eFKa" Perspektywy miesięcznika podejmującego tematykę edukacyjną Polityka tygodnik społeczno-polityczny Poza Układem miesięcznik społeczno- polityczny Prawo i Życie tygodnik prawno-społeczny Przegląd Reader's Digest miesięcznik czytelniczy, skróty i opracowania artykułów z prasy całego świata Relacje miesięcznik informacyjny stosunkach polsko-szwedzkich Sukces miesięcznik Tygodnik AWS Tygodnik Powszechny katolickie pismo społeczno-kulturalne Tygodnik Solidarność ogólnopolskie pismo NSZZ "Solidarność" Unia Polska Magazyn Niezależnych Publicystów Warsaw Voice angielskojęzyczny tygodnik gospodarczy o Polsce Więź magazyn katolicki Wolnomularz Polski polski magazyn wolnomularski on-line Wprost tygodnik Zły - bez przebaczenia miesięcznik Odpowiedz Link Zgłoś
Gość: -------- Re: --------------------AQUANET----------------------- IP: *.cm-upc.chello.se 24.04.02, 02:17 PM 'postpones'cooperation with UN fact-finders By Herb Keinon And Nina Gilbert In a surprise turnaround, Israel decided last night to "postpone" its agreement to cooperate with the UN fact-finding mission, with one diplomatic official saying Israel was afraid of being "set-up." The decision was made after consultations Prime Minister Ariel Sharon held in his office with Defense Minister Binyamin Ben-Eliezer and representatives from the Defense Ministry and the Foreign Ministry who are preparing Israel's case. According to a senior diplomatic official, Israel received intelligence information the Palestinian Authority was busy setting the stage in Jenin to "cook up" evidence for the fact-finding committee "proving" a massacre had taken place. Israel, furthermore, received no assurances its representatives would be allowed into the camp to present their arguments. The official reason for the decision was that UN General-Secretary Kofi Annan had changed the fact-finding mission's terms of reference from strictly fact- finding to something more expansive. Israel is concerned, the official said, the committee will go beyond investigating what happened in Jenin to a wider probe that Israel never agreed to, and which could lead to a recommendation to Annan to set up an investigative committee or to dispatch of international observers. "The composition of the committee was done without our consultation or agreement," the official said. "We are a sovereign country and don't have to accept these types of dictates." Israel, according to this official, is also unhappy three of the four members of the committee are political officials, not military officers able to go to a battlefield and - in a detached manner - discern what happened. "It is better for us to suffer a few bad days of publicity now, rather than have to live with the consequences of a biased report later on," the official said. Earlier in the day, Sharon told the Knesset Foreign Affairs and Defense Committee he would accept the fact-finding committee because it was the "lesser of evils." He said the US made it clear it would not veto a Security Council resolution for a commission of inquiry, and that the fact-finding mission was preferable to such a commission. Foreign Ministry legal adviser Alan Baker, one of the members of the team, said earlier in the day that although Israel expected to be consulted before the committee was appointed, it did not object to the fact-finders. "All the members of the team are respected professionals who have a proven track record in the international community," Baker said. "We trust their objectivity and professionalism." Baker vehemently denied reports that one of the members of the team, former president of the International Committee of the Red Cross Cornelio Sommaruga, is anti-Israel or anti-Semitic. Washington Post columnist Charles Krauthammer wrote an article two years ago on the controversy regarding keeping Magen David Adom out of the ICRC because the Star of David is not a recognized symbol. Krauthammer quoted Sommaruga as saying, "If we're going to have the Shield of David, why would we not have to accept the swastika?" Baker, who was present at the time of the remarks, said that using this comment to allegedly show an anti-Jewish bias on Sommaruga's part "is a vile manipulation of something said in a different context." "I know the context because I was there," Baker said. "When we were talking about adding additional emblems in the Red Cross movement, Sommaruga remembered that the old historic Indian symbol of the swastika, before it was used by the Nazis, was proposed as a humanitarian red cross symbol. To take it out of context as something he said - in an anti-Semitic context - is vile, manipulative, and destructive." Mordechai Yedid, the Foreign Ministry's deputy director-general in charge of UN and international organizations, said Sommaruga was behind a compromise that would have allowed Israel to join the organization in 2000 - but that meeting was postponed after the current violence broke out, and has not yet been rescheduled. At the same time, other diplomatic officials said Israel's relations with the ICRC hit an all-time low when Sommaruga was its head - largely over allegations of torture of security prisoners. These relations improved, however, after a meeting Sommaruga had with then-Shin Bet head Ami Ayalon. One of the other members of the fact-finding committee, Sadako Ogata, the former UN high commissioner for refugees, received an honorary doctorate from Ben-Gurion University two years ago. In her speech, Ogata said: "Israel is a country rooted in history's worst tragedies of forced human displacement, and millions of refugees owe their tragic plights to the Holocaust. The Jewish people have behind them hundreds of years of persecution, flight, and exile. On the other hand, not only economic migrants, but also refugees have built this country and refugees of Jewish origin have made enormous contributions everywhere." Regarding former Finnish president Martti Ahtisaari, one diplomatic official said he is of the old school European social democrats. The official said Ahtisaari has demonstrated an understanding of the complexity of the situation here, although he could not be called a "friend" or "supporter" of Israel. Annan yesterday upgraded the status of US Army Gen. William Nash from adviser to a full member of the staff, a move that pleased Jerusalem. "We wanted an American military man on the committee," Baker said. "And now we have one." A number of MKs took Sharon to task for initially agreeing to the establishment of the fact-finding committee. Foreign Affairs and Defense Committee chairman David Magen (Center) said the results of the inquiry can already be predicted and they "won't be complementary to Israel." Minister-without-Portfolio and National Religious Party leader Effi Eitam, a former brigadier-general, said yesterday in a faction meeting that IDF drones had filmed all of the activities during the operation in Jenin. He said it would be better to hand over the tapes to the UN than to allow soldiers who participated in the operation to testify before the inquiry. One official presenting Israel's case said the staff is considering whether to use the film from the drones, basing their decision on whether the resolution of the pictures is of a high-enough level. Former prime minister Binyamin Netanyahu also came out against the committee, telling Israel Radio it "will produce results that will harm Israel. It is completely illegitimate." "The UN has proven its bias by its failure to examine an endless number of terror attacks against Israel," Netanyahu said from the US, where he is on a mission to enlist support for Israel. He also said the UN had withheld information and misled Israel about the abduction of three soldiers by Hizbullah Odpowiedz Link Zgłoś
Gość: פ-ש-מ .................Arabia Saudyjska ......... IP: *.cm-upc.chello.se 24.04.02, 18:19 Saudi troops mass on border with Jordan following reports of Israeli military buildup Tue Apr 23,11:44 AM ET RIYADH, Saudi Arabia - Saudi Arabia has sent eight brigades to its border with Jordan after receiving intelligence reports that Israel was massing troops along the Jordanian border, Saudi officials said Tuesday. In Israel, an army spokesman said Israel had not increased its troops along the border with Jordan. Some countries neighboring Israel have stepped up their military readiness in response to Israel's call-up of its reserves, a U.S. official in Washington has said recently. However, there was no sign of any offensive activities, according to the official. The eight brigades, compromising 8,000 soldiers equipped with armored personnel carriers and missile launchers, moved into the Tabuk region in northern Saudi Arabia, the officials said. They said Saudi intelligence reports showed that Israeli forces had amassed on Israel's southern border with Jordan. A 25-kilometer (15.5-mile) strip of Jordanian territory separates Israel from Saudi Arabia. Orders for the brigades to advance to the border were given last week, said the officials. The officials said the Saudi air force was instructed to intercept Israeli fighters that enter Saudi airspace and engage them only if the Israeli fighters didn't leave. Tabuk is about 1,500 kilometers (930 miles) northeast of the Saudi capital, Riyadh. Saudi Arabia, which does not recognize the state of Israel, proposed a peace plan in March that offers Arab recognition of Israel in exchange for a full retreat from war-won lands and the establishment of a Palestinian state. The massing of troops on the border coincides with a visit by Saudi Crown Prince Abdullah to the United States on Tuesday. He is due to meet U.S. President George Bush in Texas on Thursday. Odpowiedz Link Zgłoś
alef1 EDUKACJA PALESTYNSKA 24.04.02, 20:23 www.pmo.gov.il/english/nave/opening.html Odpowiedz Link Zgłoś
wojo_czyli_smrod_na_forum [...] 05.11.02, 06:51 Wiadomość została usunięta ze względu na złamanie prawa lub regulaminu. Odpowiedz Link Zgłoś
Gość: "<l>sS]" Re: --------------------AQUANET----------------------- IP: *.wroclaw.dialog.net.pl 24.04.02, 20:32 ~~h'123'!!@,A<'S''; <@<#<#<$<%<^<&^<<<(<) >!>@>#>$>%>^>&>&>* Odpowiedz Link Zgłoś
Gość: ok :<= 2a Re 2a =<: IP: *.cm-upc.chello.se 25.04.02, 03:35 -----------AQUANET--------------- Autor: Gość portalu: "<l>sS]" Data: 24-04-2002 20:32 adres: *.wroclaw.dialog.net.pl ~~h'123'!!@,A<'S''; <@<#<#<$<%<^<&^<<<(<) >!>@>#>$>%>^>&>&>* Gość portalu: a<=3 napisał(a): > s<=4 to jest ok Odpowiedz Link Zgłoś
Gość: s:ł:owa :alCAABAla: IP: *.cm-upc.chello.se 25.04.02, 05:23 :za:klęcia: p:a:::n:i:e mmmmmmmmGIA :alCAABAla: Odpowiedz Link Zgłoś
Gość: m:y:śli :alCAABAla: : eRRe: e:s:t IP: *.cm-upc.chello.se 25.04.02, 10:31 : s:ł:owa stał:Y się OBRAzKAMI datsh.freeservers.com/images/oszolomzen.gif :za:klęcia: p:a:::n:i:e mmmmmmmmGIA :alCAABAla: VIzJA SłUcH cZyN leligia nonDeistow talmud zion fiction holy stone of aRAPs al = a/merican*israe/l lah = pl = polish allah = pl.USA.iL 2 3לąty = 6Star w 3D Odpowiedz Link Zgłoś
alef1 :alCAABAla: d:Z:i:a:L:a.N:i:a 25.04.02, 21:07 Gość portalu: m:y:śli napisał(a): > : s:ł:owa stał:Y się OBRAzKAMI datsh.freeservers.com/images/oszolomzen.gif > :za:klęcia: > p:a:::n:i:e > mmmmmmmmGIA > :alCAABAla: > VIzJA SłUcH cZyN > leligia nonDeistow > talmud zion fiction > holy stone of aRAPs > al = a/merican*israe/l > lah = pl = polish > allah = pl.USA.iL > 2 3לąty = 6Star > w 3D ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ÿÄ¢ Odpowiedz Link Zgłoś
Gość: GANIMEDA .............................................MARS IP: *.cm-upc.chello.se 26.04.02, 23:50 www.mallorcaweb.net/masm/mitmar1.htm M A R S To 229 million km of the Sun and with an orbit of 688 days, Mars is first of the planets that are beyond ours. He is relatively small, little more than half of the diameter of the Earth, but its proximity to us assures a quite shining appearance to him. It has two moons, Deimos and Fobos, this last so next one to the Mars surface that it orbits around the planet in 7.5 hours. The Mars atmosphere is similar to the one of the Earth. It seems to have water and I oxygenate and a temperature in the surface that I could arrive at the 25ºC. for that reason it is a possibility the existence of some form of life as we know it. Distance from the Sun (Semimajor axis of orbit) 227,936,640 km 1.52366231 A.U. Mean Equatorial Radius 3,397 km (0.5326 of Earth's radius) Volume (Earth = 1) 0.149 Mass 0.64191 x 1027 kg Density 3.94 gm/cm3 Surface Gravity 371 cm/s2 Escape Velocity 5.02 km/s Sidereal Rotation Period (Earth days) 1.02595675 Sidereal Orbit Period (Earth years) 1.88071105 Mean Orbit Velocity 24.1309 km/s Orbit Eccentricity 0.09341233 Orbit Inclination to Ecliptic 1.85061 degrees Inclination of Equator to Orbit 25.19 degrees Mean Temperature at Solid Surface 186 to 268 K Major Atmospheric Constituents 1CO2, N2, Ar Natural Satellites Phobos, Deimos During several centuries, the Martian characteristics observed by the telescope have generated hopes in an extraterrestrial civilization. Most important of them she is the one of the channels , peculiar lines that seem too regular like being a natural phenomenon. The space probes have left in clear that, aside from a giant tube which cmo Agathodaemon or Valles Marineris is known, those lines are, dissapointing thing, products of an optical illusion. Yes there have been more recent conjectures around the formation unexplained in pyramid form that are seen clearly in the images taken by satellites. Symbolically, Mars shows a cultural coherence compared greater than the one of other planets, perhaps as a result of its clear red tonality, produced by the iron oxide concentration in its surface. The red one has been associated universally with the fire and the blood. Still more, Mars governs the iron, a metal that takes red color during the oxidation, that is used for arms and that work to the fire. In China, the red planet was associated to the element fire, the heat of the summer and the heart. The taoístas alqimistas saw it like cinnabar, the red mercury sulfite. The origins of the common name of Mars, Mentiroso Chispeante , are not known, but their secondary names of Star of Punishment and Guardian of the Law, agreed are comprehensible the existing connection between Mars and the maintenance of the civic ritual, a vital element of the Chinese confuciana culture. Young that its heat was able to produce droughts. A typical application of the law of correspondences maintained that when Mars was in the star field of the well (vigesimosegunda lunar mansion Ching , approximately in the West of Gémini), it augured the drying of wells; and cmo this star group also represented the capital of the Empire, that the wells of this one would be affected. From the time of the first civilizations of Mesopotamia, Mars adopted a malevolente identity like gentleman of deads, carrier of the pestilencia and the war. Its older well-known form was sumeria Lugalmeslam, that governed the inferior world to which the Sun travels all the nights. From a principle, this deity seems to be assimilated to Nergal , the main Mars representative between the mesopotámicos. Call to be responsible for to have insulted to the emissary of Ereshkigal, the goddess of the infraworld, was ordered to him to Nergal that descended to the kingdom of the goddess; but the God of the wisdom, Ea, noticed to him that it did not accept anything of her. The assistants of Ereshkigal offered a chair to him, but he did not seat; they took to bread and beer to him, but he did not eat nor he drank; they presented/displayed a palangana to him, but he did not want to wash itself. Then Ereshkial went to bathe and allowed that Nergal saw a moment its body; it at first, resisted, but when the beautiful goddess let itself see again, Nergal yielded. They were loved during six days, and to seventh, Nergal returned to the superior world. Ereshkigal threatened inciting to rebellion to deads d such way that were in the superior world more deads than alive, unless it were given back loved his. The God, not indeed grudgingly, was sent again to the infraworld to govern it with Ereshkigal jointly. This story has certain number of significant parallelisms. There is a similar mesopotámico story of Ishtar (the Venus of the Romans) that descends to the infraworld, having to understand two histories altogether. In addition, the emparejamiento of Nergal and Ishatar are a recurrent subject in all the later symbolism of Mars and Venus. In a classic mythology, to Nergal was assimilated to him immediately with the Greek God You plow , that stops the Roman ones was Mars, God of the war. The Greeks did not have to You plow in excessive consideration, and cultured l of You plow, that was believed original of Thrace, very was not spread in old Greece and, where he existed, he lacked social or moral meaning. Plow it was an ancestral deity of Tebas and had a temple in Athens, on the foot of the Areópago or hill of You plow, but the Romans raised to Mars like a military God. Plow or Mars loved the war without reason some, and like mercenario he was indifferent to the reason or sinrazón of the party by which he fought. Most of the other Gods they despised it, except Eirs, goddess of the dispute, and Aphrodite (Venus) goddess on which he exerted a perverse and rather little recommendable fascination. The relation between both was desvergonzadamente erótica. The emparejamiento of Mars and Venus has gotten to personify the sexuality and the sexual difference. In modern science the planetary glifos of these two planets are even the corresponding ones to the male and the female. In Greek mythology Bellona or Belona and in Roman mythology Duellona single- breasted uniform jacket was a Roman divinity that passed through sister or wife of Mars. Imagined it with a lance, a whip or a torch, and used to also take to helmet or shield; for that reason the Romans identified it with the Greek goddess Enio. One treats, apparently, of one old Sabina divinity whose primitive name was Nerio and whose cult was introduced in Rome by the Sabina family of the Claudios . He had a temple in the Mars field , and in him he waited for the Senate to the generals who returned triunphadors of a campaign, as well as to the foreign embassies, that could not enter the enclosure of the city; there the declarations of war were made also. As a result of the war against Mitridats, the cult of the great minorasiatic lunar goddess was introduced in Rome , that was assimilated to Belona; a temple was built and a school of priests and capadocios priestesses was created, who the day of the festivity of the goddess celebrated a procession dressed in black tunics, provided with the double Eastern axe and accompanying to their dance with trumpets and drums. Bellona was identified, like Nerio, with Minerva. Mithology Sun Moon Mercury Venus Mars Jupiter Saturn Odpowiedz Link Zgłoś
Gość: اللאΘ Re: .............................................MARS IP: *.cm-upc.chello.se 26.04.02, 23:53 www.mallorcaweb.net/masm/mitmar1.htm Odpowiedz Link Zgłoś
Gość: Θللا א Re: .............................................MARS IP: *.cm-upc.chello.se 27.04.02, 00:42 Gość portalu: napisał(a): www.mallorcaweb.net/masm/mitmar1.htm .................................... spacekids.hq.nasa.gov/2003/ Odpowiedz Link Zgłoś
drf Re::al:// CAABAla:d:Z:i:a:L:a.N:i:a-Ma.Gi.Q/Pl/ 23.11.03, 22:35 Pi to one MILLION decimal places 3.141592653589793238462643383279502884197169399375105820974944592307816406286208 9986280348253421170679 82148086513282306647093844609550582231725359408128481117450284102701938521105559 64462294895493038196 44288109756659334461284756482337867831652712019091456485669234603486104543266482 13393607260249141273 72458700660631558817488152092096282925409171536436789259036001133053054882046652 13841469519415116094 33057270365759591953092186117381932611793105118548074462379962749567351885752724 89122793818301194912 98336733624406566430860213949463952247371907021798609437027705392171762931767523 84674818467669405132 00056812714526356082778577134275778960917363717872146844090122495343014654958537 10507922796892589235 42019956112129021960864034418159813629774771309960518707211349999998372978049951 05973173281609631859 50244594553469083026425223082533446850352619311881710100031378387528865875332083 81420617177669147303 59825349042875546873115956286388235378759375195778185778053217122680661300192787 66111959092164201989 38095257201065485863278865936153381827968230301952035301852968995773622599413891 24972177528347913151 55748572424541506959508295331168617278558890750983817546374649393192550604009277 01671139009848824012 85836160356370766010471018194295559619894676783744944825537977472684710404753464 62080466842590694912 93313677028989152104752162056966024058038150193511253382430035587640247496473263 91419927260426992279 67823547816360093417216412199245863150302861829745557067498385054945885869269956 90927210797509302955 32116534498720275596023648066549911988183479775356636980742654252786255181841757 46728909777727938000 81647060016145249192173217214772350141441973568548161361157352552133475741849468 43852332390739414333 45477624168625189835694855620992192221842725502542568876717904946016534668049886 27232791786085784383 82796797668145410095388378636095068006422512520511739298489608412848862694560424 19652850222106611863 06744278622039194945047123713786960956364371917287467764657573962413890865832645 99581339047802759009 94657640789512694683983525957098258226205224894077267194782684826014769909026401 36394437455305068203 49625245174939965143142980919065925093722169646151570985838741059788595977297549 89301617539284681382 68683868942774155991855925245953959431049972524680845987273644695848653836736222 62609912460805124388 43904512441365497627807977156914359977001296160894416948685558484063534220722258 28488648158456028506 01684273945226746767889525213852254995466672782398645659611635488623057745649803 55936345681743241125 15076069479451096596094025228879710893145669136867228748940560101503308617928680 92087476091782493858 90097149096759852613655497818931297848216829989487226588048575640142704775551323 79641451523746234364 54285844479526586782105114135473573952311342716610213596953623144295248493718711 01457654035902799344 03742007310578539062198387447808478489683321445713868751943506430218453191048481 00537061468067491927 81911979399520614196634287544406437451237181921799983910159195618146751426912397 48940907186494231961 56794520809514655022523160388193014209376213785595663893778708303906979207734672 21825625996615014215 03068038447734549202605414665925201497442850732518666002132434088190710486331734 64965145390579626856 10055081066587969981635747363840525714591028970641401109712062804390397595156771 57700420337869936007 23055876317635942187312514712053292819182618612586732157919841484882916447060957 52706957220917567116 72291098169091528017350671274858322287183520935396572512108357915136988209144421 00675103346711031412 67111369908658516398315019701651511685171437657618351556508849099898599823873455 28331635507647918535 89322618548963213293308985706420467525907091548141654985946163718027098199430992 44889575712828905923 23326097299712084433573265489382391193259746366730583604142813883032038249037589 85243744170291327656 18093773444030707469211201913020330380197621101100449293215160842444859637669838 95228684783123552658 21314495768572624334418930396864262434107732269780280731891544110104468232527162 01052652272111660396 66557309254711055785376346682065310989652691862056476931257058635662018558100729 36065987648611791045 33488503461136576867532494416680396265797877185560845529654126654085306143444318 58676975145661406800 70023787765913440171274947042056223053899456131407112700040785473326993908145466 46458807972708266830 63432858785698305235808933065757406795457163775254202114955761581400250126228594 13021647155097925923 09907965473761255176567513575178296664547791745011299614890304639947132962107340 43751895735961458901 93897131117904297828564750320319869151402870808599048010941214722131794764777262 24142548545403321571 85306142288137585043063321751829798662237172159160771669254748738986654949450114 65406284336639379003 97692656721463853067360965712091807638327166416274888800786925602902284721040317 21186082041900042296 61711963779213375751149595015660496318629472654736425230817703675159067350235072 83540567040386743513 62222477158915049530984448933309634087807693259939780541934144737744184263129860 80998886874132604721 56951623965864573021631598193195167353812974167729478672422924654366800980676928 23828068996400482435 40370141631496589794092432378969070697794223625082216889573837986230015937764716 51228935786015881617 55782973523344604281512627203734314653197777416031990665541876397929334419521541 34189948544473456738 31624993419131814809277771038638773431772075456545322077709212019051660962804909 26360197598828161332 31666365286193266863360627356763035447762803504507772355471058595487027908143562 40145171806246436267 94561275318134078330336254232783944975382437205835311477119926063813346776879695 97030983391307710987 04085913374641442822772634659470474587847787201927715280731767907707157213444730 60570073349243693113 83504931631284042512192565179806941135280131470130478164378851852909285452011658 39341965621349143415 95625865865570552690496520985803385072242648293972858478316305777756068887644624 82468579260395352773 48030480290058760758251047470916439613626760449256274204208320856611906254543372 13153595845068772460 29016187667952406163425225771954291629919306455377991403734043287526288896399587 94757291746426357455 25407909145135711136941091193932519107602082520261879853188770584297259167781314 96990090192116971737 27847684726860849003377024242916513005005168323364350389517029893922334517220138 12806965011784408745 19601212285993716231301711444846409038906449544400619869075485160263275052983491 87407866808818338510 22833450850486082503930213321971551843063545500766828294930413776552793975175461 39539846833936383047 46119966538581538420568533862186725233402830871123282789212507712629463229563989 89893582116745627010 21835646220134967151881909730381198004973407239610368540664319395097901906996395 52453005450580685501 95673022921913933918568034490398205955100226353536192041994745538593810234395544 95977837790237421617 27111723643435439478221818528624085140066604433258885698670543154706965747458550 33232334210730154594 05165537906866273337995851156257843229882737231989875714159578111963583300594087 30681216028764962867 44604774649159950549737425626901049037781986835938146574126804925648798556145372 34786733039046883834 36346553794986419270563872931748723320837601123029911367938627089438799362016295 15413371424892830722 012690147546684765357616477379467520049 Odpowiedz Link Zgłoś
Gość: TeSt tesT IP: *.cm-upc.chello.se 27.04.02, 15:16 www.al-islam.org/encyclopedia/shia1b.txt Odpowiedz Link Zgłoś
Gość: tEsT terroristi palestinesi IP: *.cm-upc.chello.se 27.04.02, 16:25 GERUSALEMME - Due terroristi palestinesi hanno attaccato stamane l'insediamento di Adura, a ovest di Hebron, nel sud della Cisgiordania, uccidendo quattro coloni israeliani e ferendone altri nove. Lo hanno riferito fonti locali. Tra le vittime dell'incursione c'è anche una bambina di tre anni, Daniel Saefi, raggiunta da un colpo di kalashnikov in piena fronte, mentre era nella sua camera da letto. Citato dalla radio militare, il capo della polizia israeliana in Cisgiordania, Shakhar Ayalon, ha detto che i due aggressori sono riusciti a darsi alla fuga e che nella zona è ora in corso un massiccio rastrellamento alla loro ricerca. Secondo Ayalon, i due palestinesi potrebbero essersi diretti a Hebron, che è poco distante, che secondo fonti palestinesi verrebbe al momento sorvolata da elicotteri da combattimento israeliani. In un primo momento si era temuto che i due aggressori si fossero barricati in un'abitazione dell'insediamento di Adura con alcuni ostaggi, ma una perquisizione casa per casa non ha dato alcun esito. In una prima ricostruzione dell'episodio di stamattina, era stato riportato dal sito on line del quotidiano israeliano Ha'aretz che un solo palestinese era entrato in una casa dell'insediamento aprendo il fuoco sulla famiglia che vi risiedeva, attaccando poi una seconda abitazione. Più tardi, è stato accertato che gli assalitori erano due. Il padre della bimba uccisa, un poliziotto, non era in casa al momento dell'assalto, era andato nella vicina sinagoga per pregare. La madre della piccola e gli altri due figli sono invece riusciti a fuggire, mettendosi in salvo. I due terroristi sarebbero riusciti a penetrare all'interno della colonia aprendosi un varco nella rete di recinzione, indossando uniformi dell'esercito israeliano, complete anche di giubbotti antiproiettile. Secondo la polizia, i palestinesi sono riusciti a fuggire dal campo forse attraverso la stessa via dalla quale erano entrati e non si sa se siano stati feriti. La caccia all'uomo da parte delle forze di sicurezza israeliane continua. (27 aprile 2002) Odpowiedz Link Zgłoś
datsh GERUSALEMME 27.04.02, 22:22 Mark Steyn It's time to snap out of Arab fantasy land www.NewsAndOpinion.com | Don't get me wrong. I like the British papers, if only when compared with the unreadable US broadsheets. But it has to be said that, since September 11, Fleet Street hasn't done its reputation any favours, stampeding herd-like toward one mirage after another - "the mighty Pashtun warrior, humbler of empires"; "the fast-approaching brutal Afghan winter", due to arrive any day now; the "living hell of Guantanamo", where the medical staff outnumber the detainees, etc. All very entertaining. But sooner or later I think readers have the right to expect their newspapers to get something right. Aside from "Sven And Ulrika's 3am Tryst", I mean. Instead, we have the alleged Israeli massacre of civilians at Jenin. In Friday's London Telegraph, Terje Roed-Larsen, the "UN special coordinator for the Middle East peace process", described the devastation at the refugee camp as "horrific beyond belief". It may yet prove the worst human-rights atrocity since, oh, the Dutch took charge at Srebrenica, but so far one can't help noticing a curious sameness about this week's fevered dispatches. All rely on the same couple of eyewitnesses - "Kamal Anis, a labourer" (Times), "Kamal Anis, 28" (Telegraph), "A quiet, sad-looking young man called Kamal Anis" (Independent) - and the same handful of victims - "A man named only as Bashar" (Telegraph), "the burned remains of a man, Bashar" (Evening Standard), "Bashir died in agony" (Times). You'd think with so many thousands massacred there'd be a bigger selection of victims and distraught loved ones, wouldn't you? But apparently not. I do hope my friends in the British press aren't being led up the humanitarian garden path one mo' time. For a more nuanced view, one turns to the Egyptian papers. Al- Ahram this week contains a fascinating interview with "Omar", a top bomb-maker who managed to escape from Jenin on Wednesday. "Of all the fighters in the West Bank we were the best prepared," he says. "We started working on our plan: to trap the invading soldiers and blow them up." So Omar and his pals booby-trapped more than 50 houses in the camp. "We cut off lengths of mains water pipes and packed them with explosives and nails. Then we placed them about four metres apart throughout the houses - in cupboards, under sinks, in sofas." That was just the interior decor. Outside, they placed more powerful bombs in garbage cans and cars. But don't worry about all those "innocent" civilians. As Al-Ahram reported, "According to Omar, everyone in the camp, including the children, knew where the explosives were located so there was no danger of civilians being injured." Thank goodness for that. Omar's account is confirmed by the state of the corpses ("What appeared to be pipe bombs were partially hidden under a coat"). So you can understand why the UN's head man, Mr Roed-Larsen, would rather talk about "unacceptable" Israeli conduct than why his "refugee" camp (funded by British taxpayers) is, in fact, a bomb factory with on-site demonstration facilities. Mr Roed-Larsen's operation is a large part of the problem in the region. It's possible he himself hasn't a clue what's going on: that appeared to be the case 18 months ago, when Hizbollah guerrillas crossed over from Lebanon in UN-marked cars, abducted three IDF soldiers and murdered them, and Mr Roed-Larsen's subordinates embarked on a nine-month cover-up of relevant video evidence. The intemperate grandee might once again merely be out of the loop. But it beggars belief that officials on the ground in the UN-managed camp weren't aware of the scale of terrorist activities: there are only so many blind eyes you can turn. That's what's "horrific beyond belief": that the UN is complicit in terrorism. Which raises the one question that matters: why is the Jenin refugee camp still there? The Palestinians are the only people on earth with their own permanent UN agency - the Union Nations Relief and Works Agency for Palestine Refugees, established shortly after the Arabs lost their first dumb war against Israel in 1948. It was assumed UNRWA would be a temporary effort, as they usually are, and that the Arab nations would soon take over responsibility. But the Arabs shrewdly calculated that the Palestinians were more use to them in UN hands. So here we are in Jenin, a "refugee camp" about to celebrate its golden jubilee. Founded in 1953, it's been a refugee camp under Jordan, under Israel, under the Palestinian Authority. It's a refugee camp older than most African, Caribbean or Pacific states. But the UNRWA still launches its "emergency" appeals, for an emergency from 54 years ago, when the IDF halted the Iraqis at Jenin. Go back to the other great refugee tides of that time: imagine if the millions of displaced persons in Europe at the end of the war or in the Indian sub- continent after partition were today maintained in camps, along with their children, and grandchildren, and great-grandchildren - three generations none of whom had ever lived in the places they're supposed to be refugees from. In whose interest would that be? In Jenin, it's the UN that breeds "hopelessness" and "frustration", and enables and shelters terrorism. There was no massacre, just the natural consequence of the UN's foetid administration: if you let your charges build a bomb factory, don't be surprised if it blows up. Odpowiedz Link Zgłoś
Gość: VeHu WIELKIE KLAMSTWO.... IP: *.cm-upc.chello.se 28.04.02, 01:27 Mona Charen THE BIG LIE SUCCEEDS ... AGAIN www.NewsAndOpinion.com | Several members of the Nobel Committee have expressed regrets about the Peace Prize that was jointly awarded to Yasser Arafat and Shimon Peres in 1994. This is certainly understandable Odpowiedz Link Zgłoś
patience Re: WIELKIE KLAMSTWO....the truth hurts? 18.07.04, 22:44 Walka o władzę w Gazie. Jaser Arafat mianował szefem służb bezpieczeństwa swego siostrzeńca. W proteście tysiące ludzi wyszło na ulice Gazy, a rząd Ahmeda Kurei podał się do dymisji Najpoważniejszy jak dotąd kryzys w Autonomii Palestyńskiej zaczął się od porwań. W piątek uzbrojeni napastnicy uprowadzili dyrektora koordynacji wojskowej południowej części terytoriów palestyńskich płk. Chalida Abu Alulę, szefa palestyńskiej policji generała Ghazi al Dżabaliego oraz pięcioro francuskich wolontariuszy z obozu uchodźców Chan Junis. Do porwań przyznały się dwie mało aktywne bojówki związane z ruchem Fatah prezydenta Jasera Arafata. Porywacze ogłosili, że jest to protest przeciwko korupcji w policji i władzach Autonomii. Wszystkich uprowadzonych wkrótce uwolniono. ... Analitycy są zdania, że narasta walka o władzę w Autonomii, a zwłaszcza w Strefie Gazy przed zapowiedzianym wycofaniem Izraela. Walczą ze sobą konkurencyjne frakcje w Fatahu, posługując się bojówkami, które również szukają dla siebie prominentnego miejsca w nowej rzeczywistości politycznej. Uważa się, że za piątkowymi porwaniami stoi Mohamed Dahlan, były szef MSW i krytyk odwołanego szefa policji Dżabalego. Dahlan, ceniony przez USA i Egipt, przez rywali uznawany jest za marionetkę Izraela i Ameryki. Stąd pogłoski, że za rozruchami w Gazie stoją służby izraelskie. - Albo Arafat zrobi rewolucję w swoich władzach, albo naród palestyński zrobi rewolucję przeciw niemu - mówił agencji AP Ahmed Jamous, student palestyńskiego uniwersytetu Bir Zeit. Jednak według źródeł palestyńskich cytowanych przez izraelski dziennik "Haarec" Arafat wciąż jest niezagrożony. Może to być natomiast koniec rządów Kurei, który skupi na sobie odium krytyki za złe funkcjonowanie Autonomii i brak reform. serwisy.gazeta.pl/swiat/1,34180,2184525.html Before I defected to America from Romania, leaving my post as chief of Romanian intelligence, I was responsible for giving Arafat about $200,000 in laundered cash every month throughout the 1970s. I also sent two cargo planes to Beirut a week, stuffed with uniforms and supplies. Other Soviet bloc states did much the same. Terrorism has been extremely profitable for Arafat. According to Forbes magazine, he is today the sixth wealthiest among the world's "kings, queens & despots," with more than $300 million stashed in Swiss bank accounts. "I invented the hijackings [of passenger planes]," Arafat bragged when I first met him at his PLO headquarters in Beirut in the early 1970s. He gestured toward the little red flags pinned on a wall map of the world that labeled Israel as "Palestine." "There they all are!" he told me, proudly. The dubious honor of inventing hijacking actually goes to the KGB, which first hijacked a U.S. passenger plane in 1960 to Communist Cuba. Arafat's innovation was the suicide bomber, a terror concept that would come to full flower on 9/11. forum.gazeta.pl/forum/72,2.html?f=13&w=14269925&a=14270756 Odpowiedz Link Zgłoś
Gość: datsh "Jeningrad" ... Arafata IP: *.cm-upc.chello.se 02.05.02, 23:58 May. 2, 2002 Arafat defiantly leaves Ramallah compound By LAMIA LAHOUD Palestinian Authority Chairman Yasser Arafat defiantly left his Ramallah compound Thursday for the first time in almost two months following the IDF’s withdrawal on Wednesday night. Flashing a V-for-victory sign to cheering supporters, Arafat smiled as the crowd chanted, “With our spirit and our blood, we will redeem you, oh Arafat.” He squinted in the sunlight as he stepped from his office into a black Mercedes to begin a tour of the battle-scarred city. Asked how he felt as he toured a ministry building, Arafat pointed to a group of children and said: “One of these children will wave the flag over a Palestinian state.” Arafat toured Ramallah in the morning and told Palestinians that the first priority was to rebuild the Palestinian cities. He visited the destroyed security compounds, including the Preventive Security Service compound of West Bank security chief Jibril Rajoub in Beitunia and toured PA ministries that have been damaged. He also went to the Al-Sheikh Zayed Hospital, and visited a grave of about 30 Palestinians who had been killed during the IDF incursion. Jubilation over Arafat’s release was tempered by anger over a UN decision to call off a probe into Israel’s assault on the Jenin refugee camp and a standoff at Bethlehem’s Church of the Nativity, where troops shot dead a Palestinian man Thursday. Arafat called the Bethlehem siege a “religious crime.” Palestinian officials claimed Arafat emerged as the winner in his standoff with Prime Minister Ariel Sharon over the handover of six wanted Palestinians, and was now more popular than ever. Arafat, one PA source said , was now able to declare a cease-fire which would lead to American pressure on Sharon to go ahead with the American proposal for a package combining security with political talks and economic aid to rebuild PA institutions and the Palestinian police. But Hamas warned Thursday that it would not abide by any cease-fire and that it intends to renew suicide attacks against Israelis. In a BBC interview, Hamas official Abed el-Aziz Rantisi, said that his organization would begin a wave of terror attacks against Israel in the coming days and weeks. A senior PA security official said Arafat would wait with a cease-fire declaration until Sharon’s visit to Washington next week. Whether the US pressures Sharon into accepting the US plan and resume negotiations simultaneous with the implementation of a cease-fire or immediately afterwards , Arafat will do his best to enforce it. If Sharon insists on a cease-fire without committing to the resumption of negotiations based on a US and Saudi plan, Arafat is unlikely to agree to declare a cease-fire, the security official added. Shortly after Israel lifted the siege on his compound on Wednesday night following the implementation of a US deal by which four Palestinians involved in the murder of Tourism minister Reahavam Zeevi as well as Karine A weapon ship suspect Fuad Shubaki and the PFLP leader Ahmed Saadat will be jailed in a Jericho prison, under the supervision of British and US observers, Arafat strongly attacked Israel. He called Israeli actions during Operation Defensive Shield “barbarian activities” and said fanatics who assassinated Prime Minister Yitzhak Rabin were now in power in Israel. He also compared Israeli practices to those of the Nazis and said Jenin refugee camp would from known on be called “Jeningrad,” referring to the Nazis’ bloody encirclement of Stalingrad during World War II. Late Wednesday night Arafat accused Israel of attacking the Church of the Nativity, where a groups of wanted Palestinians are holed up with clergymen and Palestinian civilians. Palestinians claim Israel opened fire on Palestinian gunmen triggering a fire in the church on Wednesday, while the IDF said the soldiers fired back at gunmen who opened fire. Israeli spokesmen denied any involvement with the fire. “It is not important what happened to me here. What is important is what is happening in the Church of the Nativity. This is a dirty crime,” Arafat told reporters in his Ramallah offices. Arafat had hoped that the stand-off over the gunmen in the church would put Israel under international pressure. While accusing Israel, the Palestinian leader said he still had hope that the peace process could be resumed. “I believe if there is a will, there is a way,” he said . However, he hinted that he did not believe the Sharon government was a peace partner. “I can’t forget myself the peace of the brave, which I had signed with my partner Rabin, who [was] killed by these fanatic groups who are in power now in Israel,” he said. Arafat also praised the IDF soldiers who refused to serve in the territories and said he believed most Israelis and Palestinians want peace. Palestinians said that a short time before their withdrawal from Ramallah, the IDF blew up three buildings near Arafat’s offices. Palestinians said Arafat might travel soon to Egypt to meet with Egyptian President Hosni Mubarak. Arafat’s adviser and spokesman Nabil Abu Rudaineh said Arafat would first stay a while in Ramallah before resuming trips abroad. “President Arafat will begin traveling abroad, but first wants to focus on the ongoing crises in the West Bank,” Abu Rudaineh said. (News agencies contributed to this report) Odpowiedz Link Zgłoś
Gość: ...info ...........peace and good government ? IP: *.cm-upc.chello.se 03.05.02, 17:40 Tough challenges await freed Arafat Palestinian leader must have two goals: peace and good government, PAUL ADAMS reports By PAUL ADAMS With reports from Reuters and AP Friday, May 3, 2002 – Page A9 RAMALLAH, WEST BANK Odpowiedz Link Zgłoś
Gość: gif ...................ISLAM HATES &# 8220;The Other&# 8221; IP: *.cm-upc.chello.se 04.05.02, 16:43 THE ASSASSINATION OF US JOURNALIST DANIEL PEARL: ISLAM HATES “The Other” http://www.ci-ce-ct.com/frameset.asp http://www.ci-ce-ct.com/images/assasinations/executed.jpg Contrary to ill-informed media comment imbued with liberal assumptions, the kidnapping and decapitation of US journalist Daniel Pearl in Pakistan was not an act of 'senseless or irrational violence'; he was targeted for assassination by terrorists. His death was not “tragic”; it was the result of an Islamic terrorist operation whose inspiration, and most likely training, was from Bin Laden. Pearl’s death was certainly not at variance with Islamic precepts and history, which has avidly employed assassination as a political tool and to humiliate targets for over fifteen hundred years. Pearl’s sympathy for Islam According to media reports, Pearl was 'sympathetic to Islam' and in 1998 criticised the US cruise missile attack codenamed Infinite Reach against the El Shifa plant in Sudan on 22 August 1998. The CIA assessed the factory was involved with the production of chemical weapons and had been concerned with the link between bin Laden and Sudan and his professed interest in chemical weapons and warfare since the end of the Gulf war in 1991. In his series of critical articles against US claims of chemical weapons manufacture in the Sudan, Pearl wrote ‘the hardest evidence is a scoop of soil and judged by the US to contain a chemical used to make nerve gas. But other evidence becomes murkier the closer you look'. If he had looked “closer' he may have found that the CIA had located the 'scoop of soil' from an agent source in December 1997, which contained 2.5 % times the normal trace of EMPTA, a chemical precursor used to produce the nerve gas VX. The formula is unique to the Iraq weapons of mass destruction program. The CIA provided the Clinton administration with all-source information including agent reports, satellite photographs, and communications intelligence, to verify the plant's covert objectives. Iraq was a valued customer of the chemical plant. Under the pretext of buying medicines, Iraqi officials associated with the chemical weapons programme had travelled to Khartoum and helped establish the plant. Intercepts revealed contacts between senior Shifa officials and Emad al Ani, popularly known as 'father’ of Iraq’s chemical weapons program. Further, Bin Laden had resided in Sudan from 1991-1996. However, Pearl was armed with the liberal journalist’s most valued asset- 'scepticism' towards the US government. He was described by the former Asian editor of the Wall Street Journal in a newspaper article published in Pakistani papers 'as a friend of Arabs and Muslims, who often supported their cause and as a person whose reporting had at times cast the US in a negative light'. Pearl was kidnapped whilst seeking 'to interview leaders of Islamic groups- trying to publicise the views of the Muslim world'. At the time of his abduction, Pearl was researching a hot story in one of the world’s terrorist hot zones; namely the links between British shoe bomber Richard Reid and Al Qaida. Such field work is intrinsically dangerous and best conducted covertly by intelligence organisations, not Western journalists. Pearl was seduced into a sophisticated terrorist operation involving strategic deception, operational pseudonyms ( the person he was introduced to prior to the kidnapping used the pseudonym 'Bashir'). The National Movement for the Restoration of Pakistani Sovereignty, which claimed responsibility for the kidnapping, was a fictional organisation using false identities, untraceable emails, cellular phones (bought with false name and address) and the promise of a clandestine meting with a particularly dangerous terrorist identity based in Pakistan. Pearl was a good man, a brave man. Pearl did not understand Islam. Those who do not understand Islam will be its victims. Pearl assassination: Al Qaida methodology The terrorists followed Al Qaida methodology: - protracted surveillance of the target - tactical and strategic deception - clandestinity - symbolic targeting, and - traditional warning to investigators. Three senior Pakistani investigators received calls from terrorists using Pearl's mobile phone warning them to drop investigations. The terrorists knew the details of the investigators families; how many children, the schools the children attended, their routes to school and the places where their families shopped. They also had detailed and precise information about the activities of their family members. Assassination is central to Islam An historical study of Islam reveals that assassination is central to Islam. Mohammed’s approval was sufficient reward for assassinations and assassination was used by ‘warriors' to atone for failing to live to Islamic precepts. Mohammed passed sentences on those he deemed unfit to live and authorised assassinations of prominent persons or those on its peripheries, 'hypocrites', whose behaviour offended him. Their deaths increased the fervour of believers. Purifying or consolidating the nucleus of believers by martyrdom, terrorism and assassinations in particular, was the precondition for the expansion of Islam. Muhammad employed military forces and assassins during the emigration (hijra) to create the ideal Islamic society. Assassination was no longer used for tactical reasons and most significantly ceased only after decisive military defeats of the assassin based sects in the eleventh and twelfth century. Assassination: Psyswar and humiliation of the target Assassination is central to psychological warfare. To demonstrate commitment, the assassins violated and hit their targets in intimate encounters and in the context of their most cherished feelings. Umay ibn “Adi, the first assassin, killed his kinswoman (a poet who mocked Mohammed) 'asleep with her children around her. The youngest, still at her breast lay asleep in her arms'. The context in which the assassination occurred was all-important. The victim was struck in a sacred context which was also the source of power, family or tribe; the secondary aim was to humiliate the target. Historical Background to Islamic assassination According to the Qur’an, sura XLV11, verses 3 and 4,'When you meet the unbelievers strike off their heads, and when you have laid them low bind them firmly'. Since the death of the Prophet in 632, assassination, clandestine warfare, tactical and strategic deception, espionage, internecine strife and terrorism has provided the matrix for the development of Islam. Of the fifty-five caliphs (successors) list, including the first four caliphs, between eighteen (31 per cent) to twenty six (43 per cent) were assassinated over the right to rule the Muslim community. (i) Omar Ibn Khattab, the second Caliph and Islam’s second greatest conqueror (after the Prophet) was assassinated with a poisoned dagger (3 November 644) (ii) The third Caliph Otman Ibn Affan was assassinated by a group of soldiers at his home (17 June 656) (iii) The fourth caliph and first Iman of the Shi’ites, Otman ibn Affa was struck by a Kharajite assassin using a long sword whilst was praying in the Mosque of Kufa in Mesopotamia (February/March 661) In 681, Hussein, the oldest son of Ali claimed the caliphate or right of succession. In consequent battles and a climactic battle against Yazhid, he died a martyr’s death as leader of a small band of believers against Yazhid’s overwhelming force of 4000. He was the last to fall. He was decapitated and his head was presented to Yazhid. Martyrdom was thereby Odpowiedz Link Zgłoś
wild2 Re: ...................ISLAM HATES &# 8220;The Other&# 8221; 15.05.02, 17:40 Oooooo, wreszcie pan dochtór online )) Pomocy, mój funfel znów ma omamy i zwidy tyż O jakichś dziuplach i własnościach gada tera ( Co robić zanim oddziałowa znuw przjdzie do niego z zastrzykiem??? On w porządalu jest, tylko za dużo sie naumiał i dlatego tak gada.... No i wypić łon tyż lubieje, tak jak pan dochtór Odpowiedz Link Zgłoś
Gość: drF Re: ...................ISLAM HATES &# 8220;The Other&# 8221; IP: *.cm-upc.chello.se 15.05.02, 20:32 wild2 napisał(a): > Oooooo, wreszcie pan dochtór online )) > Pomocy, mój funfel znów ma omamy i zwidy tyż O jakichś dziuplach i > własnościach gada tera ( > Co robić zanim oddziałowa znuw przjdzie do niego z zastrzykiem??? > On w porządalu jest, tylko za dużo sie naumiał i dlatego tak gada.... No i > wypić łon tyż lubieje, tak jak pan dochtór ______________________________________________________________________ ......ide na konferencje w swiat realny z kolegami a w miedzyczasie prosze sie dobrze zachowywac i nie wyrywac umywalek i nie zwalac winy na swoich side personalities... pamietac autoterapia... pz dr F Odpowiedz Link Zgłoś
wild2 Do Pana Dochtóra F 15.05.02, 21:53 Szanownz Panie Dr F ) Te umywalki u nasz na oddziale to nie my porywali, jeno ONI !!! Aułterapie z kąputermy my tyż robili, ale cóś nie wyszło, bo funfel mój jakiegoś promieniowania chiba dostał, bo czegóś taki promienny sie stał ;? Wołać te blądyne oddziałową czy poczekać???? Jak pan dochtór myśli? Bo Pan to dochtór, a ja tylko funfel męgo beściaka... > Odpowiedz Link Zgłoś
Gość: drF Od Pana Dochtóra F................................ IP: *.cm-upc.chello.se 16.05.02, 01:42 wild2 napisał(a): Szanownz Panie Dr F ) Te umywalki u nasz na oddziale to nie my porywali, jeno ONI !!! Aułterapie z kąputermy my tyż robili, ale cóś nie wyszło, bo funfel mój jakiegoś promieniowania chiba dostał, bo czegóś taki promienny sie stał ;? Wołać te blądyne oddziałową czy poczekać???? Jak pan dochtór myśli? Bo Pan to dochtór, a ja tylko funfel męgo beściaka... > __________________________________________________________________- Promieniowanie to rezultat autoterapii i nalezy je wykorzystac przy czytaniu broszurek w szufladzie nocnego stolika w sypialni bo dzisiaj swiatlo w sanatorium wysiadlo/ czyzby ONI ?/a blondyna oddzialowa jest na szkoleniu z SchizofreniiKomputerowej wiec radzcie sobie z funflem besciaka sami...-) Ja mysle ze dacie sobie rade bo mam do was duzo zaufanie... Pz dr F Odpowiedz Link Zgłoś
wild2 Re: Pan Dochtór F.:))) 16.05.02, 02:47 Łoj, łoj, pan dochtór to zawsze taki sympaticzny dla nas ))) A dobrze, że tej blądyny dziś wieczór nima ))) A pewnie, funfel, beściak i ja w dodatku zawsze se rade damy ) To znaczy sie, pan dochtór tyż pozwoli, naszygo tu, ale mocnego)) łoj. lepiej uważać jak ktoś niepżywykły ))) Gul gul, zdruuuuffko, panie dochtórze Mnie tam pana kurwacja kąputerowa pomogła, innzm od nas z sali chiba nie ( sam pan dochtór widzi, no nie )) Odpowiedz Link Zgłoś
Gość: DrF Pan Dochtór F.:))) do wilda2 IP: *.cm-upc.chello.se 17.05.02, 18:54 wild2 napisał(a): > Łoj, łoj, pan dochtór to zawsze taki sympaticzny dla nas ))) oczywiscie ))))))))))))))))))))) > A dobrze, że tej blądyny dziś wieczór nima ))) B.dobrze........-) > A pewnie, funfel, beściak i ja w dodatku zawsze se rade damy ) Bez najmniejszych watpliwosci...........-) > To znaczy sie, pan dochtór tyż pozwoli, naszygo tu, ale mocnego)) łoj. lepiej > uważać jak ktoś niepżywykły ))) tylko 1 dla towarzystwa....:<> > Gul gul, zdruuuuffko, panie dochtórze GulGul Zdruffffko ( > Mnie tam pana kurwacja kąputerowa pomogła, innzm od nas z sali chiba nie ( > sam pan dochtór widzi, no nie )) Wszystkie kurwacje kąputrowe bez wtyczek i kontaktow ni maja sensu , nieprawdaz? pz dr F Odpowiedz Link Zgłoś
wild2 Re: Wild2 do Pana Dochtóra F.:))) 17.05.02, 18:59 Witamy, witamy pana dochtóra )) Kurwacje som zawsze dobri Te jenzykowe tyż ) prosim spojrzeć, jakie muj funfel postenpti zrobił na innych wontkach ) A inne tak nażekojom na kąputri ) Long live IT !!!! )) I pan dochtór tyż of kors )) Odpowiedz Link Zgłoś
wild2 Re: Wild2 do Pana Dochtóra F igen 17.05.02, 19:10 Sorry, panie Dr F, my wcześniej nie ponjali Znaczi sie, Pan Dr F, tyż już sie z nami napił??? )) Oh, thanks, tack skall Ni ha, herr dr F )) No to może jeszcze po jednym? )) Please?? ) Zdruuufffko )) Odpowiedz Link Zgłoś
Gość: :///\\\: ............................................. IP: *.cm-upc.chello.se 15.05.02, 20:24 www.radio80.co.il/audio.html Odpowiedz Link Zgłoś
wild2 Re: ........fale rużne 16.05.02, 03:05 znaczy siem, pan dochtór też promieniuje, i to falami )) No, no,.... aby tylko nie zachuśtało zbytnio jak mnie z funflem u nasz na oddziale ostatnio ) Łoj, jak my żygali potem, jak koty... hihiiiihiihi Zdruuufkooo )) Odpowiedz Link Zgłoś
Gość: DrF .......fale rużne...podczerwien,aura,charyzma..etc IP: *.cm-upc.chello.se 17.05.02, 19:27 wild2 napisał(a): > znaczy siem, pan dochtór też promieniuje, i to falami )) kazdy promieniuje ale glownie w podczerwieni tak wiec bedziemy sie cwiczyc w promieniowaniu aury w widzialnym zakresie a tosie nazywa charyzma... dobrze sie cwiczyc w niebieskim kolorze bo to uspakaja stargane nerwy... nastepny krok to okulistyka aby te kolory zobaczyc...a to jest w nastepnym turnusie..))) > No, no,.... aby tylko nie zachuśtało zbytnio jak mnie z funflem u nasz na > oddziale ostatnio ) > Łoj, jak my żygali potem, jak koty... hihiiiihiihi > Zdruuufkooo )) Zyganie jest bardzo skuteczna metoda na odtrucie, nalezy je praktykowac cwiczyc az do mistrzowstwa... Pz dr F Odpowiedz Link Zgłoś
wild2 Re: .......fale rużne...podczerwien,aura,charyzma..etc 17.05.02, 19:34 Oooooooooo )) Pan dochtór tyż lubi niebieski kolor ) Ale u nas moża nie ma... tylko ZIELONO NAM, bo tu puszcza zielona )) I żubrówka takoż Any other suggestions ??? ) (łoj, te kąputri, oni są verri OK med språket) Odpowiedz Link Zgłoś
Gość: drf ..fale rużne...zieleń,aura,charyzma..Känslospråket IP: *.cm-upc.chello.se 17.05.02, 20:45 wild2 napisał(a): > Oooooooooo )) > Pan dochtór tyż lubi niebieski kolor ) > Ale u nas moża nie ma... tylko ZIELONO NAM, bo tu puszcza zielona )) I > żubrówka takoż > Any other suggestions ??? ) (łoj, te kąputri, oni są verri OK med språ > ket) ZIELONY sie doskonale nadaje do promieniowania, wplywa na regeneracje tkanek i na oczyszczenie z nadmiaru żubrówki...)))))) angående språket så rekomenderar jag Känslospråket ... This next time... Pz dr F Odpowiedz Link Zgłoś
wild2 Re: ..fale rużne...zieleń,aura,charyzma..Känslospråket 17.05.02, 21:25 Känslopråuk (som vi såuger häur i Skåune) jest zawszeu ważnueym ) Med vänlig hälsning ¨Wild 2 Odpowiedz Link Zgłoś
wild2 Re: .......fale rużne...podczerwien,aura,charyzma..etc 17.05.02, 21:38 Aaaaaa ))) Pan dochtór lepiej do nas na MAS znaczy sie w Malmo nie przychodzi ((( Odpowiedz Link Zgłoś
Gość: drF ..fale rużne...podczerwien,aura,charyzma..Malmö IP: *.cm-upc.chello.se 17.05.02, 21:57 niezbadane sa drogi opatrznosci....-)))))) pzdrF Odpowiedz Link Zgłoś
wild2 Re: ..fale rużne...podczerwien,aura,charyzma..Malmö 17.05.02, 22:21 Guds vägar äro utgrudnliga So they say in the Lund thingy Skåååååål, buddy Odpowiedz Link Zgłoś
Gość: drF Re: ..fale rużne...Guds vägar äro utgrudnliga IP: *.cm-upc.chello.se 17.05.02, 22:59 wild2 napisał(a): > Guds vägar äro utgrudnliga > So they say in the Lund thingy > Skåååååål, buddy _______________________________________________ Skåååååål Odpowiedz Link Zgłoś
wild2 Dr F :)) Bättre med kanslispråket? ;)) 17.05.02, 22:05 Inte det ( Se på dig och mig osså Odpowiedz Link Zgłoś
wild2 Re: Dr F :) Väd läste du i S???? 17.05.02, 23:11 Uppsala? Skhlm? Gtbrg? Kanske Lund? ) Odpowiedz Link Zgłoś
Gość: drF Re: Dr F :) Väd läste du i S???? IP: *.cm-upc.chello.se 17.05.02, 23:52 Uppsala ........och Du ? Odpowiedz Link Zgłoś
Gość: drF Re: Dr F :) Väd läste du i S???? IP: *.cm-upc.chello.se 18.05.02, 00:09 ........Filosofi Fast det är bättre att ha lite hemligheter eller hur ? ))))) Odpowiedz Link Zgłoś
Gość: DrF ...........Dr F :)) Bättre med kanslispråket? ;)) IP: *.cm-upc.chello.se 17.05.02, 23:49 wild2 napisał(a): > Inte det ( Se på dig och mig osså _______________________________________________ Där har du slagit spiken i huvudet ......wild2 /...people as numbers and objects in virtual corporate reality .../ {...kanslispråket liknar propaganda eller reklamspråk som har för syfte att manipulera,kontrolera och styra...} ........hälsningar pzdr F Odpowiedz Link Zgłoś
wild2 Re: ...........Dr F :)) Bättre med Absolut??? ;) 18.05.02, 08:24 Jag läste något nästan lika så opraktiskt som filosofi, min käre herr dr Och lite hemligheter ska vi alla ha lov till, osså mig ) Men snälla,låt dem alla andra fortsätta at tro at jag är den där polske swir från B-stock, hehehheehe )) Det vill de sååå gärna No to zdruuuffkoo, panie dochtórze ) Skåul på dig ! Ent chew e najs łykent )Med eller utan Absolut ) Odpowiedz Link Zgłoś
wild2 Re: .....Dr F ??? 18.05.02, 09:46 Skåul föur faaaaun )) Är det kallt där nere nu? ) Inte hos oss i alla fall U nasz świeci słoneczko, znaczy siem blądina oddziałowa, ta gruba ze strzikawkom , ta sama co za funflem całi czas lata... A ona jak żubr po żubrówce wygląda, hihihihihi Czirs, panie dochtórze )) Odpowiedz Link Zgłoś
Gość: drf .....Dr F ??? IP: *.cm-upc.chello.se 18.05.02, 22:54 har varit på ...klonerna anfaller med min dotter och är disponibel för kommunikation i Adam Michnicks forum...det är kallt i Stockholm...... har vi kanske träffats ngn gång ? i Köpenhamn ? men det är inte så viktig... du kan nå mig på titta@chello.se om du vill... pzdrfia drf Odpowiedz Link Zgłoś
dr_frojd Re: .....Dr F ??? 09.06.03, 00:19 forum.gazeta.pl/forum/72,2.html?f=32&w=6398987 Odpowiedz Link Zgłoś
Gość: DrF ...Mycke Bättre med Absolut!!! ;)....Dr F :)) IP: *.cm-upc.chello.se 18.05.02, 22:37 wild2 napisał(a): Jag läste något nästan lika så opraktiskt som filosofi, min käre herr dr Och lite hemligheter ska vi alla ha lov till, osså mig ) Men snälla,låt dem alla andra fortsätta at tro at jag är den där polske swir från B-stock, hehehheehe )) Det vill de sååå gärna No to zdruuuffkoo, panie dochtórze ) Skåul på dig ! Ent chew e najs łykent )Med eller utan Absolut ) ________________________________________________________________ Självklart käre Wild2 jag är med på noterna...det är kul att bli förstådd men det ännu roligare att INTE bli det........))))..Missförstå mig rätt...)) Hew e gud tajm ...and az aj tink jumor iz dy najses ting in dy łord end dy best medysyn, Låt dom jävlarna läsa runor, for fan...Zdruffffko Wild2!!!!-)))) Jumor doktor PZ DR F Odpowiedz Link Zgłoś
wild2 Re: ...Mycke Bättre med Absolut!!! ;)....Dr F :)) 19.05.02, 00:19 Käre dr F )) Runor är de bästa ) Bortsett från Absolut åf kårs ) Jag tror dock inte at vi nånsin har träffats (vilket är synd i och för sig lol) Med silveraktiga hälsningar ) (*där* har vi ju träffats ) PS. Ha en god pingst )) Odpowiedz Link Zgłoś
zupagrzybowa Re: ...Mycke Bättre med Absolut!!! ;)....Dr F :)) 19.05.02, 00:47 Önskar dettsamma Vi hörs... drf inCog(n)ito Odpowiedz Link Zgłoś
wild2 Re: ...Mycke Bättre med Absolut!!! Zupo G. :) 19.05.02, 00:56 Sam jusz nie wiem , kto jest kim (( U nasz na oddziale tak jest (( Czy ja to ja... czy inny wild??? Czy herr dr F är zupa g_ eller nån annan (( Tack för hälsningar anyway )) Vi (dvs alla vildar) skal nok tömma allt Systemsbolagets magasin under helgen, hehheehhhhe Skåul, föur faaaaan )) Odpowiedz Link Zgłoś
Gość: DrF "(((:Swiat toAbsolutna ZupaGrzybowa...:))))" IP: *.cm-upc.chello.se 19.05.02, 02:01 wild2 napisał(a): > Sam jusz nie wiem , kto jest kim (( U nasz na oddziale tak jest (( > Czy ja to ja... czy inny wild??? Czy herr dr F är zupa g_ eller nån annan > (( > Tack för hälsningar anyway )) > Vi (dvs alla vildar) skal nok tömma allt Systemsbolagets magasin under helgen, > > hehheehhhhe > Skåul, föur faaaaan )) Skåul föur Faaaan !!!! Det är himla svårt med Skåuńska ....-)))) Varfäur åuker Du inteu till Kobenhavn ? Äur inteu sprit billigareu där ...? Aha Wild2 tutaj naprawde nie wiadomo kto jest kto, a jak wiadomo to tez nie pomaga ........jak w sztuce(albo w szpitalu psychiatrycznym) ...autor stwarza role a potem role stwarzaja autorow ...-))) Man ska integrera alla sina roller föur Faaaan Skåul !!! PZdRf Odpowiedz Link Zgłoś
wild2 W Barszczu Przygód? 19.05.02, 08:27 Tak siem nazywała jakaś ksionżka u nasz w byblotece oddziałowej ) Skåunska är inte ett språuk, det är helt enkelt en psykisk åukomma lol Og København er dejligt, ikke også? Life is a cabaret anyway ) Pozdro, panie dochtórze F... ouch skåul föur faaaun gul gul..aaaaa. Det var bättre Odpowiedz Link Zgłoś
Gość: n0str0m0 w rosole powiklan IP: 202.108.191.* 19.05.02, 08:42 jesli czytales i polubiles barszcz przygod - zreferuj znam tylko druga czesc tej trylogii w rosole powiklan i pechc chcial ze sie mi zawieruszyla... nostromo Odpowiedz Link Zgłoś
wild2 Zupa rulez :)) 19.05.02, 08:52 Przyznam się, że nie pamiętam, bo to była dawna lektura ( Pozostał mi w pamięci jedynie tytuł, bo lubieje zupy ) A szczególnie barszcz Odpowiedz Link Zgłoś
Gość: DrF Re: W Barszczu Przygód? IP: *.cm-upc.chello.se 19.05.02, 15:13 Robert Ostaszewski Polska proza innowacyjna w perspektywie postmodernizmu Krzysztof Uniłowski, Polska proza innowacyjna w perspektywie postmodernizmu. Od Gombrowicza po utwory najnowsze, Wydawnictwo Uniwersytetu Śląskiego. Katowice 1999 Krzysztof Uniłowski, krytyk „FA-artu” związany z Uniwersytetem Śląskim, jest jednym z nielicznych literaturoznawców, którzy o postmodernizmie w polskiej prozie piszą rzetelnie i bez uprzedzeń. Już poprzedni krytycznoliteracki tom tego autora Skądinąd zawierał sporo ciekawych uwag. Kolejna książka – Polska proza innowacyjna w perspektywie postmodernizmu daje szerszy wykład poglądów autora. W niej stara się przede wszystkim ukazać polskie korzenie postmodernizmu w prozie, udowodnić, że nie jest on jedynie – jak niektórzy sądzą – obcym szczepem na pniu naszej literatury, pielęgnowanym przez zapatrzonych w zagraniczne nowinki literaturoznawców. Analizy Dzienników Gombrowicza, powieści Sam wyjdę bezbronny Parnickiego i niektórych tekstów Lema (m.in. Dzienników gwiazdowych) kreślone przez Uniłowskiego pokazują, w jaki sposób ci pisarze, zajmując się – odpowiednio – krytyką podmiotu, problemem dyskursywizacji historii i określaniem statusu autora, docierają do granic modernizmu, wytyczając niejako dalszą drogę postmodernistom. Śledząc przemiany prozy innowacyjnej w latach siedemdziesiątych i osiemdziesiątych, autor stara się zrekonstruować proces kształtowania się nurtu postmodernistycznego. Początki tego nurtu odnajduje jeszcze w roku 1979, kiedy pojawiły się powieści Marka Słyka (W barszczu przygód) i Anatola Ulmana (Cigi de Montbazon). Tłumaczy również, dlaczego świadomość postmodernistyczna została wytłumiona w latach osiemdziesiątych. Podaje dwie główne przyczyny takiego stanu rzeczy: uwikłanie literatury powstającej w tych latach w historię oraz przypisanie rodzącej się prozy postmodernistycznej do tak zwanej szkoły Berezy, której podopieczni zostali zepchnięci w cień przez pisarzy lansowanych przez Błońskiego. Szkoda tylko, że wywód Uniłowskiego urywa się w miejscu, w którym właściwie zaczyna robić się najciekawiej. Prozę postmodernistyczną powstającą po roku 1989 autor przedstawia jedynie w telegraficznym skrócie. _________________________________________________________ pozdro Odpowiedz Link Zgłoś
wild2 Re: W Barszczu Przygód? 19.05.02, 15:18 Tack skall du ha )) Synd at vi inte fick det hela av hans essä Jag har känt Marek S på 70 talet och hoppas att han blev bättre med tiden ) Odpowiedz Link Zgłoś
Gość: DrF Re: W Barszczu Przygód? IP: *.cm-upc.chello.se 19.05.02, 15:39 W barszczu przygód / Marek Slyk. LC Control Number: 81155982 Type of Material: Book (Print, Microform, Electronic, etc.) Brief Description: Slyk, Marek. W barszczu przygód / Marek Slyk. Wyd. 1. Warszawa : Iskry, 1980. 385 p. : ill. ; 20 cm. _________________________________________ Library of Congress URL: www.loc.gov/ Mailing Address: 101 Independence Ave, S.E. Washington, DC 20540 pz dr F Odpowiedz Link Zgłoś
wild2 Re: W Barszczu Przygód? 19.05.02, 15:47 Mange tak fra København ) pozdro også I ZDRUUUFKKOO, panie dochtórze )) PS.To nie my wyrwali umywalki na oddziale, to ONI ) Odpowiedz Link Zgłoś
Gość: drf Re: W Barszczu Przygód? IP: *.cm-upc.chello.se 19.05.02, 16:06 Wszystkie szuki Szekspira ftp://ftp.ibiblio.org/pub/docs/books/gutenberg/etext00/00ws110.txt The Tempest Actus primus, Scena prima. A tempestuous noise of Thunder and Lightning heard: Enter a Ship-master, and a Boteswaine. Master. Bote-swaine. Botes. Heere Master: What cheere? Mast. Good: Speake to th' Mariners: fall too't, yarely, or we run our selues a ground, bestirre, bestirre. Enter. Enter Mariners. Botes. Heigh my hearts, cheerely, cheerely my harts: yare, yare: Take in the toppe-sale: Tend to th' Masters whistle: Blow till thou burst thy winde, if roome enough. Enter Alonso, Sebastian, Anthonio, Ferdinando, Gonzalo, and others. Alon. Good Boteswaine haue care: where's the Master? Play the men. Botes. I pray now keepe below. Anth. Where is the Master, Boson? Botes. Do you not heare him? you marre our labour, Keepe your Cabines: you do assist the storme. Gonz. Nay, good be patient. Botes. When the Sea is: hence, what cares these roarers for the name of King? to Cabine; silence: trouble vs not. Gon. Good, yet remember whom thou hast aboord. Botes. None that I more loue then my selfe. You are a Counsellor, if you can command these Elements to silence, and worke the peace of the present, wee will not hand a rope more, vse your authoritie: If you cannot, giue thankes you haue liu'd so long, and make your selfe readie in your Cabine for the mischance of the houre, if it so hap. Cheerely good hearts: out of our way I say. Enter. Gon. I haue great comfort from this fellow: methinks he hath no drowning marke vpon him, his complexion is perfect Gallowes: stand fast good Fate to his hanging, make the rope of his destiny our cable, for our owne doth little aduantage: If he be not borne to bee hang'd, our case is miserable. Enter. Enter Boteswaine Botes. Downe with the top-Mast: yare, lower, lower, bring her to Try with Maine-course. A plague - A cry within. Enter Sebastian, Anthonio & Gonzalo. vpon this howling: they are lowder then the weather, or our office: yet againe? What do you heere? Shal we giue ore and drowne, haue you a minde to sinke? Sebas. A poxe o'your throat, you bawling, blasphemous incharitable Dog. Botes. Worke you then. Anth. Hang cur, hang, you whoreson insolent Noyse-maker, we are lesse afraid to be drownde, then thou art. Gonz. I'le warrant him for drowning, though the Ship were no stronger then a Nutt-shell, and as leaky as an vnstanched wench. Botes. Lay her a hold, a hold, set her two courses off to Sea againe, lay her off. Enter Mariners wet. Mari. All lost, to prayers, to prayers, all lost. Botes. What must our mouths be cold? Gonz. The King, and Prince, at prayers, let's assist them, for our case is as theirs Sebas. I'am out of patience An. We are meerly cheated of our liues by drunkards, This wide-chopt-rascall, would thou mightst lye drowning the washing of ten Tides Gonz. Hee'l be hang'd yet, Though euery drop of water sweare against it, And gape at widst to glut him. A confused noyse within. Mercy on vs. We split, we split, Farewell my wife, and children, Farewell brother: we split, we split, we split Anth. Let's all sinke with' King Seb. Let's take leaue of him. Enter. Gonz. Now would I giue a thousand furlongs of Sea, for an Acre of barren ground: Long heath, Browne firrs, any thing; the wills aboue be done, but I would faine dye a dry death. Enter. Scena Secunda. Enter Prospero and Miranda. Mira. If by your Art (my deerest father) you haue Put the wild waters in this Rore; alay them: The skye it seemes would powre down stinking pitch, But that the Sea, mounting to th' welkins cheeke, Dashes the fire out. Oh! I haue suffered With those that I saw suffer: A braue vessell (Who had no doubt some noble creature in her) Dash'd all to peeces: O the cry did knocke Against my very heart: poore soules, they perish'd. Had I byn any God of power, I would Haue suncke the Sea within the Earth, or ere It should the good Ship so haue swallow'd, and The fraughting Soules within her Pros. Be collected, No more amazement: Tell your pitteous heart there's no harme done Mira. O woe, the day Pros. No harme: I haue done nothing, but in care of thee (Of thee my deere one; thee my daughter) who Art ignorant of what thou art. naught knowing Of whence I am: nor that I am more better Then Prospero, Master of a full poore cell, And thy no greater Father Mira. More to know Did neuer medle with my thoughts Pros. 'Tis time I should informe thee farther: Lend thy hand And plucke my Magick garment from me: So, Lye there my Art: wipe thou thine eyes, haue comfort, The direfull spectacle of the wracke which touch'd The very vertue of compassion in thee: I haue with such prouision in mine Art So safely ordered, that there is no soule No not so much perdition as an hayre Betid to any creature in the vessell Which thou heardst cry, which thou saw'st sinke: Sit downe, For thou must now know farther Mira. You haue often Begun to tell me what I am, but stopt And left me to a bootelesse Inquisition, Concluding, stay: not yet Pros. The howr's now come The very minute byds thee ope thine eare, Obey, and be attentiue. Canst thou remember A time before we came vnto this Cell? I doe not thinke thou canst, for then thou was't not Out three yeeres old Mira. Certainely Sir, I can Pros. By what? by any other house, or person? Of any thing the Image, tell me, that Hath kept with thy remembrance Mira. 'Tis farre off: And rather like a dreame, then an assurance That my remembrance warrants: Had I not Fowre, or fiue women once, that tended me? Pros. Thou hadst; and more Miranda: But how is it That this liues in thy minde? What seest thou els In the dark-backward and Abisme of Time? Yf thou remembrest ought ere thou cam'st here, How thou cam'st here thou maist Mira. But that I doe not Pros. Twelue yere since (Miranda) twelue yere since, Thy father was the Duke of Millaine and A Prince of power: Mira. Sir, are not you my Father? Pros. Thy Mother was a peece of vertue, and She said thou wast my daughter; and thy father Was Duke of Millaine, and his onely heire, And Princesse; no worse Issued Mira. O the heauens, What fowle play had we, that we came from thence? Or blessed was't we did? Pros. Both, both my Girle. By fowle-play (as thou saist) were we heau'd thence, But blessedly holpe hither Mira. O my heart bleedes To thinke oth' teene that I haue turn'd you to, Which is from my remembrance, please you, farther; Pros. My brother and thy vncle, call'd Anthonio: I pray thee marke me, that a brother should Be so perfidious: he, whom next thy selfe Of all the world I lou'd, and to him put The mannage of my state, as at that time Through all the signories it was the first, And Prospero, the prime Duke, being so reputed In dignity; and for the liberall Artes, Without a paralell; those being all my studie, The Gouernment I cast vpon my brother, And to my State grew stranger, being transported And rapt in secret studies, thy false vncle (Do'st thou attend me?) Mira. Sir, most heedefully Pros. Being once perfected how to graunt suites, how to deny them: who t' aduance, and who To trash for ouer-topping; new created The creatures that were mine, I say, or chang'd 'em, Or els new form'd 'em; hauing both the key, Of Officer, and office, set all hearts i'th state To what tune pleas'd his eare, that now he was The Iuy which had hid my princely Trunck, And suckt my verdure out on't: Thou attend'st not? Mira. O good Sir, I doe Pros. I pray thee marke me: I thus neglecting worldly ends, all dedicated To closenes, and the bettering of my mind Odpowiedz Link Zgłoś
wild2 Fuck Szekspir ,))) 19.05.02, 16:16 Panie dochtórze, u nasz na oddziale nikt nie rozumie den där rotvälska (( I ta blądina też nie potrafi, łona tilko ze strzikafkom lata (( A niby była na kursie i sie miała nałuczić, że mi tyż ludzie ; (chociasz trochem inni) ( Odpowiedz Link Zgłoś
Gość: drF : Fuck Szekspir ,))) kopie DNA autorow... IP: *.cm-upc.chello.se 19.05.02, 16:45 wild2 napisał(a): > Panie dochtórze, u nasz na oddziale nikt nie rozumie den där rotvälska (( > I ta blądina też nie potrafi, łona tilko ze strzikafkom lata (( A niby była > na kursie i sie miała nałuczić, że mi tyż ludzie ; (chociasz trochem inni) ( ________________________________________________________________________________ Wild2 to tylko na zmylke , bo adres ftp://ftp.ibiblio.org/pub/docs/books/gutenberg/etext00/ znalazlem w poszukiwaniu ksiazki twego kolegi a tyn nowy gutenberg drukuje wszystkie texty bezplatnie w calosci do ogolnego dostepu a nawet ostatnio zaczal drukowac wirtualnie cala strukture genetyczna DNA czlowieka wiec mysle ze za pare lat beda tez autorzy skopiowani a potem sie ich bedzie kopiowalo.. a oto maly fragment kodu DNA /odpowiadajacy IQ 200/: AACATTTATATCTACACAAAAACCTGCACACAGATGGTTATAGCAGCTTCATTCATAATT GCCAAAGCTTGGAAGCAACCAACATGTCCTTCAGTAGGTGAATGGATAAATAAACTCTGG TACATCCAGCCAATGGAATGTTTTTTCCATGCTAAATAAAAGAACTATCAAGCTATTAAA AGACATGAAGGAACCTCAAATGCATATTACTAGGCAAAAGAAGCTAATCTGAAAAAGCTA CACACTGTATGAGTACCTGTATATGACATTCTGAAAAAGACAGAACTATGGATACAGTAG AAAGGTCAGTGGTTCCTAGAGGTAGGGGAAGGGAGGGACAAATAGGCAGAGCATAGCGGG TTTTCAGTGTAGTGAAAATACTCTGTATGATATTATAATGGTAGATATATGTGATTGTAA ATTTTTCCAAACCTGTAGAATTTACAACACCAAGAGTGGGCCTTACATAAGCTGCAGACT CTGAGTGATGATGTGTAAATATAGAGGAATCAATTGTAACAAATACATCACTCTGATGGA GGACGTTGATAATGAGGGAGGTTGTGCATGAGAGAGAACAGGAATTCTATAAGAAATCTC TGTACCTTCTGCTCAAATTTGCTGTGAAACTAAAACTACTCTAAAAAAACAAAATCTTTA AAAAATTACTCAGCATTTAAAAAAATAGAAAAATAAGACTCATGAAGAAGAAAAAAATCA ATTCATGGGTTGATGGGTATAGCAAGCCATCATGGCACATGTATACCTGTGTAACAAACC TGCACGTTCTGCACATGTATTCCAGAACTTAAAGTATAATTAAAAAAAGAAAAAAATCAA TTCATTAAAATTGGGCCAGAAATGACATAGATGACAGAATTGGCAGTCCAGGCTTTAAAA TAATTATTGCAATTATATTTCATGTATTCAAGAAACTAGAGGAAACCTTGACATGAAAAA CATGTCAACTAGAGAGATGAATGATCATTTTAGACAGGCCCAAATTGAATTTCTAGAGAA TAAAATTACAATTTGATACAAAAATTACACTGGAAGCAATTAACAACAGTTGGACATTGT AGGAGAAAAAACTAGTGAACTTGAAGACTTAGTACTAGAAACTATCTAAGAAGGTACAAT AGCTACAAAAAAGCAAAATACATAGAGATATACTTAGCCATGGAGGCAAAAGATCTCTAT : Fuck Szekspir ,))) Odpowiedz Link Zgłoś
wild2 Re: : Fuck Szekspir ,))) kopie DNA autorow... 19.05.02, 16:52 Tusen tack, herr dr Ale mnie ten Absolut Sanning tak strasznie ściął hehehhehe, że popatrzem jutro (no i bez funfli i oddziałowej tyż ) Skåååull föuuur faaaun ))) Odpowiedz Link Zgłoś
Gość: DrF Absolut Sanning & Vita Lögner.........-))))))) IP: *.cm-upc.chello.se 19.05.02, 19:29 wild2 napisał(a): Tusen tack, herr dr Ale mnie ten Absolut Sanning tak strasznie ściął hehehhehe, że popatrzem jutro (no i bez funfli i oddziałowej tyż ) Skåååull föuuur faaaun ))) ......................................................... glad pingst och Skåååull föuuur faaaun och Skåååuuune ))) Absolut Sanning måste spetsas med ngra Vita Lögner...)) pz dr F Odpowiedz Link Zgłoś
wild2 Re: Absolut Sanning & Vita Lögner.........-))))))) 19.05.02, 19:33 Gość portalu: DrF napisał(a): > wild2 napisał(a): > > Tusen tack, herr dr > Ale mnie ten Absolut Sanning tak strasznie ściął hehehhehe, > że popatrzem jutro (no i bez funfli i oddziałowej tyż ) > Skåååull föuuur faaaun ))) > glad pingst och Skåååull föuuur faaaun och Skåå&a > ring;uuune ))) > Absolut Sanning måste spetsas med ngra Vita Lögner...)) > pz dr F --------------------- Hhehehehe )Eller kanske med Vargtass.. eller Beska Droppar? Odpowiedz Link Zgłoś
Gość: DrF ((((((-....SystemBolaget.........-))))))) IP: *.cm-upc.chello.se 19.05.02, 21:03 www.systembolaget.se/ BRÄNNVIN, okryddat Artikel med blåmarkerat pris finns i samtliga butiker Varunamn Årg Varunr Land Volym Pris Kr / liter 32 Brännvin 231 Sverige 700ml 165.00 kr ( 235.71) 350ml 94.00 kr ( 268.57) 38 Brännvin 204 Sverige 700ml 194.00 kr ( 277.14) 350ml 103.00 kr ( 294.29) 60 Brännvin 286 Sverige 700ml 314.00 kr ( 448.57) Absolut Vodka 88 Sverige 700ml 229.00 kr ( 327.14) 350ml 126.00 kr ( 360.00) 600ml 228.00 kr ( 380.00) Brännvin Special 158 Sverige 700ml 169.00 kr ( 241.43) 350ml 95.00 kr ( 271.43) Dufvenkrooks Vodka 62 Sverige 700ml 192.00 kr ( 274.29) Explorer Vodka 3 Sverige 700ml 198.00 kr ( 282.86) 350ml 105.00 kr ( 300.00) Finlandia 63 Finland 700ml 228.00 kr ( 325.71) 350ml 119.00 kr ( 340.00) 600ml 223.00 kr ( 371.67) Koskenkorva 53 Finland 700ml 199.00 kr ( 284.29) 350ml 104.00 kr ( 297.14) Koskenkorva Viina 233 Finland 700ml 195.00 kr ( 278.57) Kronvodka 4 Sverige 700ml 210.00 kr ( 300.00) 350ml 113.00 kr ( 322.86) Moskovskaya 32 Ryssland 700ml 209.00 kr ( 298.57) Patron Vodka 11 Tyskland 700ml 194.00 kr ( 277.14) Renat Brännvin 1 Sverige 700ml 204.00 kr ( 291.43) 350ml 108.00 kr ( 308.57) 500ml 169.00 kr ( 338.00) Seriously Vodka 47 Sverige 700ml 231.00 kr ( 330.00) Skyy Vodka 61 USA 700ml 229.00 kr ( 327.14) 600ml 229.00 kr ( 381.67) Smirnoff 108 Storbritannien 700ml 224.00 kr ( 320.00) 500ml 199.00 kr ( 398.00) 350ml 118.00 kr ( 337.14) Stolichnaya Cristall 77 Ryssland 700ml 249.00 kr ( 355.71) Stolichnaya Vodka 91 Ryssland 700ml 229.00 kr ( 327.14) Svensk Vodka Lake Vättern 5 Sverige 700ml 209.00 kr ( 298.57) 500ml 180.00 kr ( 360.00) Svenskt Brännvin 1467 234 Sverige 700ml 229.00 kr ( 327.14) Thors Hammer Vodka 255 Sverige 700ml 229.00 kr ( 327.14) 600ml 229.00 kr ( 381.67) Vikingfjord Vodka 298 Norge 700ml 224.00 kr ( 320.00) Wyborowa 124 Polen 700ml 217.00 kr ( 310.00) 350ml 115.00 kr ( 328.57) 600ml 254.00 kr ( 423.33) ............................................ Hälsningar drF Odpowiedz Link Zgłoś
wild2 Re: ((((((-....SystemBolaget.........-))))))) 19.05.02, 21:10 Gość portalu: DrF napisał(a): > > <a href="http://www.systembolaget.se/"target="_blank">www.systembolaget.se/</a> > > > BRÄNNVIN, okryddat > Artikel med blåmarkerat pris finns i samtliga butiker > > Varunamn Årg Varunr Land Volym Pris Kr / liter > 32 Brännvin > 231 Sverige 700ml 165.00 kr ( 235.71) > 350ml 94.00 kr ( 268.57) > 38 Brännvin > 204 Sverige 700ml 194.00 kr ( 277.14) > 350ml 103.00 kr ( 294.29) > 60 Brännvin > 286 Sverige 700ml 314.00 kr ( 448.57) > Absolut Vodka > 88 Sverige 700ml 229.00 kr ( 327.14) > 350ml 126.00 kr ( 360.00) > 600ml 228.00 kr ( 380.00) > Brännvin Special > 158 Sverige 700ml 169.00 kr ( 241.43) > 350ml 95.00 kr ( 271.43) > Dufvenkrooks Vodka > 62 Sverige 700ml 192.00 kr ( 274.29) > Explorer Vodka > 3 Sverige 700ml 198.00 kr ( 282.86) > 350ml 105.00 kr ( 300.00) > Finlandia > 63 Finland 700ml 228.00 kr ( 325.71) > 350ml 119.00 kr ( 340.00) > 600ml 223.00 kr ( 371.67) > Koskenkorva > 53 Finland 700ml 199.00 kr ( 284.29) > 350ml 104.00 kr ( 297.14) > Koskenkorva Viina > 233 Finland 700ml 195.00 kr ( 278.57) > Kronvodka > 4 Sverige 700ml 210.00 kr ( 300.00) > 350ml 113.00 kr ( 322.86) > Moskovskaya > 32 Ryssland 700ml 209.00 kr ( 298.57) > Patron Vodka > 11 Tyskland 700ml 194.00 kr ( 277.14) > Renat Brännvin > 1 Sverige 700ml 204.00 kr ( 291.43) > 350ml 108.00 kr ( 308.57) > 500ml 169.00 kr ( 338.00) > Seriously Vodka > 47 Sverige 700ml 231.00 kr ( 330.00) > Skyy Vodka > 61 USA 700ml 229.00 kr ( 327.14) > 600ml 229.00 kr ( 381.67) > Smirnoff > 108 Storbritannien 700ml 224.00 kr ( 320.00) > 500ml 199.00 kr ( 398.00) > 350ml 118.00 kr ( 337.14) > Stolichnaya Cristall > 77 Ryssland 700ml 249.00 kr ( 355.71) > Stolichnaya Vodka > 91 Ryssland 700ml 229.00 kr ( 327.14) > Svensk Vodka Lake Vättern > 5 Sverige 700ml 209.00 kr ( 298.57) > 500ml 180.00 kr ( 360.00) > Svenskt Brännvin 1467 > 234 Sverige 700ml 229.00 kr ( 327.14) > Thors Hammer Vodka > 255 Sverige 700ml 229.00 kr ( 327.14) > 600ml 229.00 kr ( 381.67) > Vikingfjord Vodka > 298 Norge 700ml 224.00 kr ( 320.00) > Wyborowa > 124 Polen 700ml 217.00 kr ( 310.00) > 350ml 115.00 kr ( 328.57) > 600ml 254.00 kr ( 423.33) > ............................................ > Hälsningar > drF -----------Znaczy siem, że Pan Dochtór też se lubi chlapnąć??? :::;;;; Skåååull, föoor faaaun))) Odpowiedz Link Zgłoś
wild2 Re: ((((((-....SystemBolaget.........-))))))) 19.05.02, 21:15 Det är faan mig MYCKET billigare i Danmark )) Du gamla, du fria och *mycket dyra* Nord, heheheheehhee Nieustajonce pozdro ) från en OCKSÅ wild en (eller två eller??? siostro!!!) Odpowiedz Link Zgłoś
Gość: drF : ((((((-....AA.....-)))))) : IP: *.cm-upc.chello.se 19.05.02, 21:57 Nykterismens Höga Visa _________________________________________________________ http://www.alcoholics-anonymous.org/ Alcoholism and Alcoholics Not too long ago, alcoholism was viewed as a moral problem. Today, many regard it primarily as a health problem. To each problem drinker, it will always remain an intensely personal matter. Alcoholics who approach A.A. frequently ask questions that apply to their own experience, their own fears, and their own hopes for a better way of life. What is alcoholism? There are many different ideas about what alcoholism really is. The explanation that seems to make sense to most A.A. members is that alcoholism is an illness, a progressive illness, which can never be cured but which, like some other diseases, can be arrested. Going one step further, many A.A.s feel that the illness represents the combination of a physical sensitivity to alcohol and a mental obsession with drinking, which, regardless of consequences, cannot be broken by willpower alone. Before they are exposed to A.A., many alcoholics who are unable to stop drinking think of themselves as morally weak or, possibly, mentally unbalanced. The A.A. concept is that alcoholics are sick people who can recover if they will follow a simple program that has proved successful for more than one and a half million men and women. Once alcoholism has set in, there is nothing morally wrong about being ill. At this stage, free will is not involved, because the sufferer has lost the power of choice over alcohol. The important thing is to face the facts of one's illness and to take advantage of the help that is available. There must also be a desire to get well. Experience shows that the A.A. program will work for all alcoholics who are sincere in their efforts to stop drinking; it usually will not work for those not absolutely certain that they want to stop. How can I tell if I am really an alcoholic? Only you can make that decision. Many who are now in A.A. have previously been told that they were not alcoholics, that all they needed was more willpower, a change of scenery, more rest, or a few new hobbies in order to straighten out. These same people finally turned to A.A. because they felt, deep down inside, that alcohol had them licked and that they were ready to try anything that would free them from the compulsion to drink. Some of these men and women went through terrifying experiences with alcohol before they were ready to admit that alcohol was not for them. They became derelicts, stole, lied, cheated, and even killed while they were drinking. They took advantage of their employers and abused their families. They were completely unreliable in their relations with others. They wasted their material, mental, and spiritual assets. Many others with far less tragic records have turned to A.A., too. They have never been jailed or hospitalized. Their too-heavy drinking may not have been noticed by their closest relatives and friends. But they knew enough about alcoholism as a progressive illness to scare them. They joined A.A. before they had paid too heavy a price. There is a saying in A.A. that there is no such thing as being a little bit alcoholic. Either you are, or you are not. And only the individual involved can say whether or not alcohol has become an unmanageable problem. Can an alcoholic ever drink 'normally' again? So far as can be determined, no one who has become an alcoholic has ever ceased to be an alcoholic. The mere fact of abstaining from alcohol for months or even years has never qualified an alcoholic to drink "normally" or socially. Once the individual has crossed the borderline from heavy drinking to irresponsible alcoholic drinking, there seems to be no retreat. Few alcoholics deliberately try to drink themselves into trouble, but trouble seems to be the inevitable consequence of an alcoholic's drinking. After quitting for a period, the alcoholic may feel it is safe to try a few beers or a few glasses of light wine. This can mislead the person into drinking only with meals. But it is not too long before the alcoholic is back in the old pattern of too-heavy drinking — in spite of all efforts to set limits for only moderate, social drinking. The answer, based on A.A. experience, is that if you are an alcoholic, you will never be able to control your drinking for any length of time. That leaves two paths open: to let your drinking become worse and worse with all the damaging results that follow, or to quit completely and to develop a new pattern of sober, constructive living. Can't an A.A. member drink even beer? There are, of course, no musts in A.A., and no one checks up on members to determine whether or not they are drinking anything. The answer to this question is that if a person is an alcoholic, touching alcohol in any form cannot be risked. Alcohol is alcohol whether it is found in a martini, a Scotch and soda, a bourbon and branch water, a glass of champagne — or a short beer. For the alcoholic, one drink of alcohol in any form is likely to be too much, and twenty drinks are not enough. To be sure of sobriety, alcoholics simply have to stay away from alcohol, regardless of the quantity, mixture, or concentration they may think they can control. Obviously, few persons are going to get drunk on one or two bottles of beer. The alcoholic knows this as well as the next person. But alcoholics may convince themselves that they are simply going to take two or three beers and then quit for the day. Occasionally, they may actually follow this program for a number of days or weeks, Eventually, they decide that as long as they are drinking, they may as well "do a good job." So they increase their consumption of beer or wine. Or they switch to hard liquor. And again, they are back where they started. I can stay sober quite a while between binges; how can I tell whether I need A.A.? Most A.A.s will say that it's how you drink, not how often, that determines whether or not you are an alcoholic. Many problem drinkers can go weeks, months, and occasionally years between their bouts with liquor. During their periods of sobriety, they may not give alcohol a second thought. Without mental or emotional effort, they are able to take it or leave it alone, and they prefer to leave it alone. Then, for some unaccountable reason, or for no reason at all, they go off on a first-class binge. They neglect job, family, and other civic and social responsibilities. The spree may last a single night, or it may be prolonged for days or weeks. When it is over, the drinker is usually weak and remorseful, determined never to let it happen again. But it does happen again. This type of "periodic" drinking is baffling, not only to those around the drinker, but also to the person still drinking. He or she cannot understand why there should be so little interest in alcohol during the periods between binges, or so little control over it once the drinking starts. The periodic drinker may or may not be an alcoholic. But if drinking has become unmanageable and if the periods between binges are becoming shorter, chances are the time has come to face up to the problem. If the person is ready to admit to being an alcoholic, then the first step has been taken toward the continuing sobriety enjoyed by thousands upon thousands of A.A.s. Others say I am not an alcoholic. But my drinking seems to be getting worse. Should I join A.A.? Many members of A.A., during their drinking days, were assured by relatives, friends, and doctors that they were not alcoholics. The alcoholic usually adds to the problem by an unwillingness to realistically face the facts of drinking. By not being completely honest, the problem drinke Odpowiedz Link Zgłoś
wild2 Re: : ((((((-....AA.....-)))))) : 21.05.02, 17:14 Dzienkujem, Panie Dr F ) Ja to "aaaa" funflowi beściakowi pokazał, ale łun nie rozumie po zagramanicznemu ( Blądina tyż niegramotna, a niby terapiem nam miała robić ( A ten apsolót art co pan dochtór wysłał, to już wogule nie dla nasz na oddziale Tilko nam kąputri zostali coby siem wyleczyć..... Zdruuuffko anyłej ) Odpowiedz Link Zgłoś
wojo_czyli_smrod_na_forum [...] 05.11.02, 06:49 Wiadomość została usunięta ze względu na złamanie prawa lub regulaminu. Odpowiedz Link Zgłoś
Gość: NIKT© Re: W Barszczu Przygód? IP: *.cm-upc.chello.se 02.07.02, 02:17 BOHM (s. 202): Materia, która z punktu widzenia fizyki jawi się jako materia gęsta, zbudowana jest w rzeczywistości z pustej przestrzeni zawierającej kilka bardzo małych cząstek krążących jak planety. Inne wysokoenergetyczne cząstki przechodzą przez to, co wydaje się być stałą materią. Wprawdzie można uważać, iż same cząstki są bardziej gęste, to jednak gdy weźmiemy pod uwagę teorię względności i teorię kwantów, okaże się, że materia musi być pojmowane również jako pole, a same jego cząstki jako zagęszczenia. Pole jest czymś uniwersalnym i rządzą nim prawa teorii kwantowej. W moim odczuciu prawa te tak naprawdę rozumiane są przez fizyków bardzo powierzchownie; jesteśmy jednak w stanie wyciągnąć z nich kilka wniosków. Jeden z nich głosi, że pole zbudowane jest z wielu rodzajów fal. Każda fala ma pewien minimalny ładunek ruchu przybierający dyskretną postać kwantu. Dla każdej fali istnieje minimalna energia, która jest niezbyt wielka, ale w pustej przestrzeni jest tak wiele fal, że ładunek, w jaki się one sumują jest ogromny. W rzeczywistości, jeżeli dopuścimy istnienie fal dowolnie krótkich, energia będzie nieskończona. A jeżeli znajdziemy jakąś rację, żeby ją ograniczyć (a mamy taką rację) w tych miejscach, gdzie możemy oczekiwać zawalenia się teorii, to gdy oszacujemy energię, okaże się, że w jednym centymetrze sześciennym pustej przestrzeni jest ona większa od energii, która wyzwoliłaby się przy anihilacji całej materii zawartej w poznanym wszechświecie. Skłania to do wniosku, że znana nam materia jest małą zmarszczką na pustej przestrzeni. W pewnym sensie przestrzeń jest bardzo gęsta, w innym sensie nie jest; przestrzeń jest bowiem ruchem i to ruchem bardzo złożonym.*BOHM (s. 44): Pole kwantowe zwiera informacje na temat całego otoczenia i całej przeszłości i ta informacja reguluje obecną aktywność elektronu w ten sam sposób, w jaki informacja o całej przeszłości i całym otoczeniu reguluje za pośrednictwem świadomości naszą własną, ludzką aktywność.*BOHM (s. 46): [...] ewolucja jest zasadą podstawową. Dotyczy to zarówno przestrzeni jak i czasu. Sam czas jest porządkiem przejawiania się. Powiemy zatem, że ukryty porządek możliwy jest zarówno w odniesieniu do czasu, jak i do przestrzeni, że w dowolnym danym okresie czas może zostać całkowicie zwinięty. Płynący czas jest w ukrytym porządku. Rzeczywistość jest ruchem całościowym, a to co się dzieje w samej głębi danej chwili zawiera informację o całości.*BOHM (s. 46): Świadomość jest być może najsubtelniejszą formą materii i ruchu, bardziej subtelnym aspektem ruchu całościowego. W porządku niejawnym przestrzeń i czas nie są od siebie oddzielne. Dotyczy to zarówno zwyczajnej materii, jak i w większym nawet stopniu, materii subtelnej, jaką jest świadomość. Jeżeli więc jesteśmy oddzieleni, to dlatego, że trzymamy się przeważnie świata jawnego jako podstawowej rzeczywistości, gdzie wszystko polega na istnieniu odrębnych, w każdym razie do pewnego stopnia, jednostek, które na siebie wzajemnie oddziałują. W rzeczywistości niejawnej wszystko wzajemnie się przenika, łączy się ze sobą - wszystko jest jednością. Gdzieś głęboko świadomość ludzkości jest jedna. Jest to faktyczna pewność, ponieważ nawet w próżni materia jest jedna; jeżeli tego nie widzimy, to tylko dlatego, że nie chcemy tego widzieć.*BOHM (s. 47): W ciszy lub w pustce nie ma ani miary przestrzeni, ani miary czasu. Otóż w owej ciszy może pojawić się mała zmarszczka, posiadająca tę miarę. Myśląc jednak, że mała zmarszczka jest wszystkim co tam jest, że przestrzeń wokół niej jest niczym, czymś bez znaczenia, powracalibyśmy do zwyczajnego poglądu, w którym wszystko rozbite jest na fragmenty.*BOHM (s. 106): W mechanice kwantowej mamy pola informacji w funkcji falowej i być może pola super-kwantowe rządzące samym polem kwantów. Pola nie znajdują się w czasoprzestrzeni, ale w przestrzeni wielowymiarowej - tak jest w każdym razie w ujęciu matematycznym. Przestrzeń i czas są również pojęciami antropomorficznymi. Są one sensami. Jeżeli powiemy, że ta superfalowa funkcja nie rządzi sama przestrzenią i czasem, to mamy wtedy pole o innym charakterze. Ale sensy czasoprzestrzenne i pole funkcji superfalowej mogą się ze sobą kontaktować, podobnie jak mogą się kontaktować wszystkie sensy wchodzące tu w grę.*EINSTEIN (s. 176): Doświadczenie mistyczne jest najpiękniejszym przeżyciem. Jest one siłą wszelkiej prawdziwej sztuki i nauki. Ten, któremu to doświadczenie jest obce, jest jakby martwy. Wiedzieć, że istnieje coś, czego nie potrafimy przeniknąć, co przejawia się jako najwyższa mądrość i olśniewające piękno, a dla naszego tępego umysłu dostępne jest w swoich najprymitywniejszych postaciach - oto wiedza i uczucie znajdujące się w centrum prawdziwej religijności. W tym sensie, i tylko w tym, należę do ludzi głęboko religijnych. Istota ludzka jest częścią całości [...] Człowiek doświadcza siebie, swoich myśli i odczuć jako oddzielnych od całej reszty. Jest to rodzaj złudzenia optycznego, któremu ulega ludzka świadomość. To złudzenie jest pewnego rodzaju więzieniem zamykającym nas w kręgu naszych osobistych pragnień i uczuć żywionych wobec kilku najbliższych osób. Naszym zadaniem powinno być wyzwolenie się z tego więzienia przez poszerzenie zasięgu tego współczucia tak, żebyśmy objęli nim wszystkie żyjące istoty i całą naturę w jej pięknie. Nikt nie jest w stanie osiągnąć tego w pełni, ale już samo usiłowanie jest częścią wyzwolenia i ugruntowania wewnętrznego bezpieczeństwa.*BOHM (s. 206): Jest tu pewna analogia w tym sensie, że wszystko co przydarza się cząstce, zależy od tego, co przydarzyło się wszystkim innym rzeczom w przeszłości. Jest to rozwijająca się w nieskończoność sieć wzajemnych połączeń. Ale pojedyncza cząstka nie ma oczywiście wyboru. W fizyce, cząstka porusza się po prostu zależnie od działających na nią sił; siły te mogą osiągnąć ogromny zakres czasowego oddziaływania. Pewne czynniki mogą być zaniedbywalne, inne zaś, jako silniejsze, nie. Jeśli jednak chodzi o wszechświat, musisz myśleć o nim jako o takiej właśnie sieci wzajemnych połączeń między cząstkami. W fizyce cząstki mogą powstawać z energii albo ulegać anihilacji łącząc się ze sobą. Jakkolwiek więc cząstki mogą istnieć długo, nie jest konieczne, żeby istniały stale. Uważa się obecnie, że każda cząstka ma ograniczony czas istnienia. Dotyczy to nawet protonu, w przypadku którego czas ten może być nawet milion razy większy od obecnego wieku wszechświata. Koniec końców jednak, każda cząstka i każda struktura cząstek rozpada się.*BOHM (s. 208): Dlaczego kamień musi pozostać kamieniem i nie może stać się czymś innym? Zastanówcie się nad tym jak rośnie roślina: wkłada się do ziemi nasiono, ale materiał pochodzi ze słońca, wody i gleby. Wszystko to gromadzi się razem samorzutnie i tworzy roślinę. Współczesna nauka stwierdza, że nasiono dostarcza przede wszystkim informacji w postaci DNA. Roślina powstaje wtedy, gdy DNA dostarczy tej informacji. Podobnie jest ze zwierzęciem. Sądzę, że tak jak mówi się o DNA, że ma ono coś w rodzaju proto-inteligencji - trochę innej niż nasza inteligencja - podobnie materia posiada pewien rodzaj proto-inteligencji sterowanej subtelną informacją. Jednak w ostatecznym rachunku niezbędne jest całe otaczające środowisko, które realizuje tę inteligencję - stąd bowiem pochodzi materiał. Trzeba więc zrozumieć zdolność do reagowania na informację - być może jest ona jakoś pokrewna inteligencji, mimo że nie jest z nią identyczna.*DALAJLAMA (s. 208): Uważam, że bez poznania świadomości bardzo trudno jest gruntownie poznać materię. Jeśli natomiast znamy współczesne, naukowe sposoby objaśniania materii, powinno to być pomocne w lepszym wyjaśnieniu świadomości. My, buddyści, wierzymy, że na rzeczywistość składają się dwie siły: materia i świadomość. Oczywiście, świadomość z Odpowiedz Link Zgłoś
wild2 Re: ...Mycke Bättre med Absolut!!! ;)....Dr F :)) 19.05.02, 15:01 zupagrzybowa napisał(a): > Önskar dettsamma > Vi hörs... > drf inCog(n)ito U nasz na oddziale to mówiom "In Koguto" ) Med vänlig hälsning Wild2 - Cogito Ergo Sum ) Odpowiedz Link Zgłoś
Gość: dRF .......................INCOGNITO ERGO SUM ? IP: *.cm-upc.chello.se 19.05.02, 21:13 wild2 napisał(a): > zupagrzybowa napisał(a): > > > Önskar dettsamma > > Vi hörs... > > drf inCog(n)ito > U nasz na oddziale to mówiom "In Koguto" ) > Med vänlig hälsning > Wild2 - Cogito Ergo Sum ) ______________________________________________________ Reasons for a monopoly The reasons are related to decisions made in an effort to minimize the harm resulting from alcohol consumption. It is our belief that limiting private profit based on alcohol sales will help reduce overall consumption. The idea is not a new one. Our experience of this system dates back to 1865, when Systembolaget’s first predecessor was established. It was founded because the average alcohol consumption of 46 liters of spirits a year per inhabitant had an undesirable effect on society. Working capacity decreased, as work-related accidents increased, and output declined. The conclusion was that as long as there was unlimited access to inexpensive alcohol, provided by private retailers, it would be hard to decrease overall consumption. Social responsibility Something had to be done, and the initiative was taken by several mine owners in the Dalecarlia province in northern Sweden. They introduced a system for selling alcohol with profits going back into the community, rather than to private interests. After this, the system was soon introduced nationwide. This system, combining alcohol sales with social responsibility, proved to be an effective instrument for reducing alcohol consumption in Sweden. This sense of social responsibility is the foundation on which Systembolaget and its activities still are built. We provide Swedish customers with alcoholic beverages, but our sense of responsibility brings about other ways of presenting our products to our customers than a private profit-seeking enterprise would use. We do not encourage people to consume alcoholic beverages. Neither do we support nor actively market any individual brand or engage in sales promotion. Of course this does not prevent the staff from giving good advice when it comes to selecting a certain beverage to go with a given kind of food. But they will never try to persuade people into buying more than they initially intended. Early drinking habits The social responsibility is especially significant when it comes to young people, defined in this case as anyone under the age of twenty, according to the Swedish Alcohol Act. Research has shown that the earlier people start to drink, the more likely they are to become alcoholics later on. We also know that young bodies suffer greater harm from alcohol. A common opinion, especially among young people, is that the minimum purchase age should be lowered to 18. By doing so, we would not only give access to alcohol among 18 and 19 year olds, but also youngsters below this age would gain easy access to wines and spirits, since their older friends would be likely to supply them. Systembolaget also supplies information about the hazards of drinking, and cooperates with several organizations to alleviate the more risky sides of alcohol. A wide product range Naturally, regardless of every good intention, our methods will be criticized by those who want a less limited access to alcoholic drinks in Sweden. One of the more frequent arguments for closing down the monopoly is that it would expand the number of items offered. However, contrary to what many believe, in this case monopoly widens, rather than restricts, product range. Few private retailers could afford – or even have room for – the kind of stock we offer. www.systembolaget.se/english/xindex.htm -------------------------------------------------------------------------------- םזגרם'ןקמןש вкА δΡφ dRf Odpowiedz Link Zgłoś
wild2 Re: .......................INCOGNITO ERGO SUM ? 19.05.02, 21:18 I DK är sprit-passande ålder på 15 år )) Thx God, så att till och med lilla mig får lov att handla nåt ) Odpowiedz Link Zgłoś
Gość: drF {{{{{{{{{{{{{{{/absolut/art/}}}}}}}}}}}}}}}}}}}}}} IP: *.cm-upc.chello.se 19.05.02, 22:10 www.lewman.com/images/www.attrition.org/gallery/spoof/Impotenc.jpg www.dadaland.com/gifs/absolut.gif www.adlerandco.com/britto/images/absolutII.gif www.dadaland.com/absolut.html www.ealowbw.dabsol.co.uk/Systems/Zero/Zero.htm __________________________________________________________ pz dr F Odpowiedz Link Zgłoś
wild2 Re: {{{{{{{{{{{{{{{/absolut/art/}}}}}}}}}}}}}}}}}}}}}} 21.05.02, 21:35 Panie Dochtórze F )) (z całym nalerznim szacónkiem) ) Funfel wreście zobacził.... i siem tak straaasznie przestrasził... łuj, rze asz blądina prziszła z tim zatrzikiem... łoj, łoj... ale strasznie biło.... usch ! Aż my siem tyż wystraszyli Odpowiedz Link Zgłoś
zupagrzybowa Re: {{{{{{{{{{{{{{{/absolut/art/}}}}}}}}}}}}}}}}}}}}}} 22.05.02, 00:29 nie ma sie co bac www.conspiratorium.20m.com/confire3.gif wszystko bendzie dobrze pzdr in coguto Odpowiedz Link Zgłoś
xzn {{{{{{{{{{{{{{{/absolut/art/}}}}}}}}}}}}}}}}} 19.03.03, 00:47 zupagrzybowa napisał(a): nie ma sie co bac ? www.conspiratorium.20m.com wszystko bendzie dobrze pzdr in coguto creatywnaParaNoja Odpowiedz Link Zgłoś
Gość: ________ __________________________________________________ IP: *.cm-upc.chello.se 27.05.02, 21:40 _______________________________________________ops Odpowiedz Link Zgłoś
