Dodaj do ulubionych

Nowy,intrygujący,pasjonujący i trudny wątek

14.02.07, 18:38
Zaręczam, że ten nowy, intrygujący, pasjonujący i trudny wątek jest znacznie
lepszy od starego, nieintrygującego, niepasjonującego i nietrudnego wątku.
Obserwuj wątek
    • Gość: Instruktor KO Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.mcon.pl 14.02.07, 20:37
      Z tych naszych rozmów wylania sie idea wystepów i... jakich jeszcze nie bylo. Stworzenia czegos zupelnie nowego. Nowa wartosc moze powstac jako synteza róznorodnych sprzecznych ze soba wartosci. Jezeli chcemy osiagnac nowa wartosc musimy doprowadzic do konfliktu miedzy tym co fizyczne, a tym co duchowe. Jezeli natura, wiec fizycznosc jest czyms pierwotnym czyli teza, to kultura jest jej antyteza, a synteza tym co pragniemy osiagnac. Gdy ktos z nas gimnastykuje sie reprezentuje nature wiec teze, jesli ktos z nas spiewa reprezentuje kulture wiec antyteze. Chcac stworzyc sztuke na nasza miare musimy zwiekszyc w niej udzial wysilku fizycznego, a dla antytezy i duchowego. I to jest nowa strategia syntezy. I to jest nowa koncepcja sztuki.
      • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 14.02.07, 20:51
        No właśnie, ja np., jak mi się czasem zdarza myśleć, to wysilam się też
        fizycznie, bo marszczę czoło, robię jakieś bardzo dziwne miny, nabrzmiewają mi
        żyły na skroniach, poruszam lewym uchem a w ogóle to lubię grzybobranie i
        śpiewać arie z Borysa Godunowa podczas nurkowania. Fajne to było co napisałeś,
        am nadzieje, że to nie koniec.
              • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 15.02.07, 11:13
                Instruktorze KO, to co piszesz uszlachetnia ten wątek, powodując, że nie tylko
                nie odbiega on jakością od wątków produkcji zachodniej lecz nawet je przewyższa.
                Mocno wierzę, że uda na się tu, Witkiewiczowski wynalazek, "czystą formę",
                przenieść ze sztuki na inne dziedziny życia, wierzę, iż uda nam się tę teorię
                znacząco rozwinąć. JEst to zadanie niezmiernie trudne, bo jeśli pozostawimy sama
                formę bez treści, to wówczas forma stanie się treścią i na nic nasze dążenia...
                Prosze o dalszą dyskusję, moze znajdzie sie jakies rozwiązanie.
            • Gość: Tik-Tak Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.mcon.pl 15.02.07, 12:44
              Instruktorze KO nie galopuj zbytnio.Sama forma jest juz treścią formalną.A, ze
              nie ma waloru obiektywizmu.To co z tego?Czy wszystko w kazdym czasie i miejscu
              musi byc obiektywne?Obiektywizm moze dorastac i narastać, az do osiagniecia max
              swego istnienia.Proste.
              Do mego duchowego, czyli Szanownego Jobravego.Zastanów sie o Wielki jak taki
              niepozorny wpis potrafi rozbudzic emocje i skojarzenia.Zapewniam, ze lepiej
              zająć sie wątkami przeraźliwie prostymi, niż bajać o urzędniczo - lustracyjnych
              niedoskonałosciach.
                • jobrave Re: Tic-tacu 16.02.07, 00:51
                  Tyś jest, tak naprawdę inspiratorem i patronem duchowym tego wątku, więc witam
                  Cię radością, przydasz sie tu zdecydowanie bardziej, niż gdzie indziej.
                  Ad rem jednak; znalezienie zarzutów a następnie osoby, do której dopasujemy te
                  zarzuty, nie będzie zadaniem szczególnie trudnym, bo wypraktykowano to już w
                  przeszłości, z efektami przechodzącymi wszelkie wyobrażenie, z usunięciem tejże
                  osoby , też raczej potrafimy sobie poradzić, ale jak juz usuniemy jedną, to
                  przydałoby się usunąć kolejną itd. itd. Jeśli poprzestaniemy na jednej, to
                  będziemy musieli wymyślić coś innego- możemy -na przykład -uznać, za zarzut brak
                  zarzutów, no ale nie ma przecież ludzi , którym nie można nic zarzucić i wtej
                  sytuacji nie pozostałoby nam nic innego jak usunąć wszystkich ludzi, a zeby było
                  sprawiedliwie, to na końcu musielibysmy usunąć samych siebie. I bądż tu mądry...
                      • jobrave Re: Hermenegildzie 16.02.07, 04:22
                        Objawiłeś się brutalnie jako profetyk przepowiadający zagładę tego wątku i
                        defetysta, bo zasiewasz zwątpienie, rezygnację. Czyżbyś znał karmę tego wątku?
                      • Gość: Tik-Tak Re: Instruktorze ko IP: *.mcon.pl 16.02.07, 07:55
                        Drogi Hermenie Twoja brutalność jest pełna zawiłego wdzięku, tak pożadanego dla
                        destabilizacji.Ale, czy ona musi aż implikować indolencję?Wydaje mi się, ze
                        nie.Nie wiem o jak dalekiej, czy też bliskiej perspektywie mówi Twój umysł, ale
                        nie bedzie to tak blisko.Nie można totalnie rezygnować.Totalitaryzm zazwyczaj
                        przegrywa w perspektywie jednak dalszej.Z miłością należną geometrii wykreślnej
                        pozostaję.
                        • Gość: hermenegildo Re: Instruktorze ko IP: *.neoplus.adsl.tpnet.pl 17.02.07, 00:15
                          Ja tylko chciałem zwrócić uwagę, że teoretycznie istnieją dwie możliwości:
                          przyjmując iż ów wątek należy do fraktali klasycznych jego miara Lebesgue'a
                          wyniesie dokładnie zero, jeśli zaś nie, to podobnie jak zbiór Mandelbrota może
                          wynosić nawet ok. 1,5 ( a w każdym razie będzie dodatnia!).
                          Pozdrawiam miłośników teorii chaosu:-)
                          • jobrave Re: Instruktorze ko 17.02.07, 01:21
                            Oczywiście przy założeniu, że fraktal jest synkretycznym odwozrowaniem ciągu
                            liczb zbioru pomniejszonego o silnię iterową przy stałym atraktorze tzw. Quantum
                            Leppera pomnożej przez 1/2 promienia ukrytego krzywej Kocha, gdzie wartość dla
                            kwantum przy zmiennej Katschinsky'ego= 0>@ i @<0 co w rezultacie daje nam
                            wartość współczynnika 365 przy zachowaniu powtarzalności Brunnhilda w
                            mulitplikacji nieseryjnej co stanowi Sx funkcję alfa ostrosłupa płaskiego.
                            Eliminując jednak kwantyfikator szczegółowy deprentora x (przy zmiennej dwolnego
                            wartości atraktora) możemy otrzymać obraz Px (K>Bx)= PiS(@+@+@........),który
                            nie jest obrazem Chełmońskiego.




                              • jobrave Re: Instruktorze ko 17.02.07, 02:18
                                Spróbuj, w takim razie, w swoich obliczeniach zastosować iter warstwowy
                                Giertycha IWG, ze zmienną wartością "G" musisz go jednak skonweniować z
                                deliptycznym funktorem prefiksu Q (gdzie Q jest jednocześnie >< Q) wówczas
                                wstawiając mantysę K w co drugi, powtarzający się ciąg liczb matrycy de Billa
                                uzyskasz wyłącznie nieparzyste liczby osób w saniach. Wspomniana przez Ciebie a
                                uporczywie pojawiając sie w Twoich obliczeniach "Czwórka..." może być również
                                efektem zmutowania się deliberatora funkcji podwójnej Płozy ale wystarczy odjąć
                                wartość równą zmiennej Sankowskiego i juz napewno uzyskasz właściwy wynik.
                                Powodzenia w obliczeniach.Gdybys miał jeszcze czymś problemy, chętnie służę
                                swoja wiedzą.
                                      • Gość: Tik-Tak Re: Instruktorze ko IP: *.mcon.pl 17.02.07, 12:05
                                        Postanowiłem dociec o co chodzi:
                                        "Przez masturbację należy rozumieć dobrowolne pobudzanie narządów płciowych w
                                        celu uzyskania przyjemności cielesnej. Zarówno Urząd Nauczycielski Kościoła
                                        wraz z niezmienną tradycją, jak i zmysł moralny chrześcijan stanowczo
                                        stwierdzają, że masturbacja jest aktem wewnętrznie i poważnie
                                        nieuporządkowanym. Bez względu na świadomy i dobrowolny motyw użycie narządów
                                        płciowych poza prawidłowym współżyciem małżeńskim w sposób istotny sprzeciwia
                                        się ich celowości. Poszukuje się w niej przyjemności płciowej poza relacją
                                        płciową, wymaganą przez porządek moralny, która urzeczywistnia w kontekście
                                        prawdziwej miłości pełny sens wzajemnego oddawania się sobie i przekazywania
                                        życia ludzkiego.
                                        I wszystko jasne!!!!!!!!!!!!!!
                                        • Gość: hermenegildo Re: Instruktorze ko IP: *.neoplus.adsl.tpnet.pl 17.02.07, 13:02
                                          To zupełnie oczywiste, że masturbacja jest aktem wewnętrznie nieuporządkowanym
                                          ponieważ rozpatrywana w układzie zamkniętym (przyjmijmy dla uproszczenia, że
                                          takim jest organizm)cechuje się stałym wzrostem entropii, zgodnie zresztą z
                                          oczekiwaniem Boltzmanna. Jeśli chodzi zaś o wzajemne oddawanie się sobie
                                          organizmów różnopłciowych, to także ono może przybierać bardzo różne formy
                                          nieuporządkowania, co z łatwością potwierdzi każdy niemal dzielnicowy.....
                                          • Gość: Tik-Tak Re: Instruktorze ko IP: *.mcon.pl 17.02.07, 14:57
                                            Nie zgadzam się.Bo czyż spółkowanie dwóch form jednopłciowych jest
                                            uporządkowane?Mam nadzieję, ze z tego układu nie umykają również inne organy,
                                            których przeznaczenie moze być i jest róznorakie.
                                            Nie uważam za celowe być filantropem dla plemników, niech walczą same o byt i
                                            to swiadomie.
                                            Równie interesujacye wydaje mi się pytanie, czy od początku powstania
                                            tych"gości"pojawiają sie wśród nich agenci?Zwłaszcza komunistyczni.Rutozyd jest
                                            mało skuteczny na uszczelnienia.
                                            • Gość: hermenegildo Re: Instruktorze ko IP: *.neoplus.adsl.tpnet.pl 17.02.07, 15:31
                                              Nie nie. Nie o to chodziło. Spółkujące formy jednopłciowe to układ wybitnie
                                              nieuporządkowany cechujący się w dodatku znacznie większą od masturbacji
                                              entalpią właściwą. Co do plemników - w chwili obecnej jest ich w kraju ok. 6
                                              biliardów (6 000 000 000 000 000),i doprawdy trudno jest dociec czy każdemu
                                              zakłada się teczkę. Rutozyd nie ma wpływu na ich ruchliwość. I pomyśleć, że
                                              kiedyś byliśmy najszybszymi z nich.......
                                              • jobrave Re: Instruktorze ko 18.02.07, 01:02
                                                Będąc dziś u swojego psychiatry podjąłem z nim poważna dyskusje w wyniku której
                                                obraziliśmy się na siebie, poszło jak zwykle o DD (dywagant deliberacyjny) ja
                                                upierałem się, że jest to wielkość zmienna, natomiast doktor twierdził, że
                                                stała. Trzasnąłem drzwiami i wyszedłem ale po drodze zajrzałem do koleżanki,
                                                która pracuje w laboratorium, zupełnie przypadkiem spojrzałem w
                                                mikroskop-plemniki były mocno nieruchawe, do każdego ogonka przywiązana była
                                                mała teczuszka.
                                                  • Gość: Tik-Tak Plemnik - agent IP: *.mcon.pl 18.02.07, 12:49
                                                    Zaskoczył mnie niemile TW pająk kosarz, który łażąc po scianie naigrywał sie z
                                                    Macierewicza.Mało tego, trzymał w wyszczerbionym pysku czerwoną pchłę i udawał
                                                    podnieconego zdobyczą.A z trawnika dochodził chichot żółtych krokusów, jakiś
                                                    dewiant z tego kosarza.Chyba za duzo nażarł sie rukoli, choć to
                                                    darmozjad.Pozostaję bez wyrazów.
                                                  • jobrave Re: Plemnik - agent 18.02.07, 14:27
                                                    W moim domu mieszka mocno rozgałęziona familia pająków, ktorą przyzwyczaiłem ,
                                                    do tradycyjnych potraw kuchni polskiej, nie mniej jednak raz w miesiącu zabieram
                                                    je do bardzo sympatycznej oberży pod pod Paryżem " Le Rucole Auberge"
                                                    usytuowanej na piątym kilometrze trasy wiodącej z Paryża do Rammbouillet.
                                                    Oberżystą jest tam,wielce życzyliwy polskim pająkom, Phillipe Payonnce, którego
                                                    sałatki z rukoli nie mają sobie równych w całym departamencie De Saint-Oise.
                                                    Jednakowoż moich podopiecznych, nienawykłych do zieleniny i warzyw, spożywanie
                                                    jej prowadzi do senscji takich jak np. raport Macierewicza o WSI czy innych
                                                    podobnego rodzaju porażających dolegliwości. Żeby nie przedłużać: "Rukola
                                                    tak-sensacje nie!"
                                                    PS. Hermenegildzie, miło mi, że się zgadzasz z mna w kwestii dywagantu
                                                    deliberacyjnego DD,jesli zaś chodzi o mojego psychiatrę, to-całkiem po
                                                    prostu-pomylił dywagant deliberacyjny z deliberantem dywagacyjnym (DDb), który
                                                    rzeczwyiści jest wielkością stałą (sensu stricto oczywiście). PS II włąśnie
                                                    wpadła mi w ręce intersująca praca Yehudy Arameha pt. " Wpływ judaizmu na na
                                                    homonimicyjną angiplezję pająków korsarzy w kontekście plemnikobójczych
                                                    pestycydów "Chwastex". Porażającą lektura!!!
                                                  • Gość: hermenegildo Re: Plemnik - agent IP: *.neoplus.adsl.tpnet.pl 18.02.07, 16:21
                                                    Wszystko się zgadza, pająki (także korsarze)nienawidzą nie tylko rukoli, ale
                                                    również wszystkich roślin zielnych z podklasy ukęślowców; co więcej
                                                    przypuszczam, iż zagrożone ponowną wizytą u W.Cz.P.Phillipe Payonnce są w
                                                    stanie wystosować notę protestacyjną, a nawet zagrozić blokadą trasy Paryż -
                                                    Rammbouillet......
                                                    Praca Yehudi Arameha była drukowana w odcinkach na łamach "Yediot Achronot"
                                                    pod koniec lat osiemdziesiątych ubiegłego wieku i prawdopodobnie była przyczyną
                                                    masowych samobójstw młodych mężczyzn zarówno w strefie Gazy jak i na Zachodnim
                                                    Brzegu Jordanu. Władze okupacyjne od tej pory wciągnęły "Chwastex"na listę
                                                    bojowych środków trujących i zdobycie go w tamtych rejonach graniczy niemal z
                                                    cudem (orientacyjny koszt 1 l - 200.000 szekli)
                                                  • jobrave Re: Plemnik - agent 18.02.07, 18:53
                                                    W takim razie polecam również (jeszcze nie napisany) traktat Impridharmy
                                                    Śhrivmabadamiego z Uniwersytetu w Dżajpurze "O konektycznej reinkarnacji pająków
                                                    międzypachwinowych i wszy łonowych indukowanej spyderolazą". Nie chciałbym
                                                    zdradzać szczegółów tej, pasjonującej lektury, wspomnę tylko, że niekopulatywne
                                                    koneksje pająków międzypachwinowych z wszami łonowymi i powstawanie, skutkują
                                                    powstaniem form hybrydowych, owe hybrydy ("krimaphriśna bhavamuti") reinkarnują
                                                    się.... i tu pozwolę sobie niedokończyć, bo naprawdę, naprawdę traktat jest
                                                    genialny i nie chcę ujawniać szczegółów , by nie psuć lektury. Dodam jeszcze, że
                                                    tylko, że najwązniejszym elementem w tym wszystkim jest enzym spyderolaza,
                                                    bytujący w żyle grzbietowej prącia (vena penis dorsalis)pająka korsarza. "Jak,
                                                    to możliwe! -zakrzykniesz-"Przecież , to koneksja niekopulatywna!". Tak , masz
                                                    rację ale na tym właśnie polega zagadka. Miłej lektury.
                                                  • Gość: hermenegildo Re: Plemnik - agent IP: *.neoplus.adsl.tpnet.pl 18.02.07, 21:38
                                                    Oczywiście spyderolaza nie może występować zarówno w żyle grzbietowej prącia
                                                    żadnego osobnika rodzaju Araneae, ani także Gastropoda i to bez względu na
                                                    koneksje (patrz teoria wiązek), ponieważ należy ona do fosforylaz aktywujących
                                                    histony (zależne zresztą od cyklicznego AMP). Nie ma zatem nawet teoretycznej
                                                    możliwości na powstawanie hybryd typu krimaphriśna bhavamuti. Poza tym rząd
                                                    Anoplura, w skład którego wchodzi wesz łonowa, nie podlega prawom reinkarnacji
                                                    w żadnej odmianie hinduizmu. Uniwersytet w Dżajpurze słynie zaś z dziwnych prac
                                                    naukowych (najprawdopodobniej plagiatów)swoich byłych doktorantów zatrudnianych
                                                    bardzo często przez północnoamerykańskie firmy w celach czysto
                                                    marketingowych......
                                                  • Gość: Tik-Tak Re: Plemnik - agent IP: *.mcon.pl 19.02.07, 16:58
                                                    Ty Hermenegildo i Ty gałganie Jobrave robisz z
                                                    Nich głupków.Ja nie zamierzam odpuścić, choć i będę dalej pisał eseje powalone,
                                                    to nie zamierzam przepraszać.Embiwalentna prawda wymaga skoszonych traw i prawd.
                                                    Dlaczego kosarze sa winne indolencji chemicznej pierwiastków zwanych zyciem?
                                                    Dzin niebios jest dłuższy od dnia o ok.276 minut rozsadnych.Liczmany nie
                                                    decyduja o ilości.
                                                  • jobrave Re: Plemnik - agent 20.02.07, 01:49
                                                    Moi Szanowni Przedmówcy (Przedwpisowcy), chyba nie zdajecie sobie sprawy,z tego
                                                    jak grożne mogą być skutki pojawienia się zbłąkanego plemnika gdziekolwiek, a tu
                                                    w szczególności. Wiadomo,że enwiromentalność adkohenrentywna tego forum jest
                                                    odwrotnie proporcjonalna do 1/4 długości ogonka zbłąkanego plemnika a to z kolei
                                                    powoduje, że współczynnik penetrantu dodatniego tegoż plemnika wynosi ni mniej,
                                                    ni więcej tylko 0,467 haotikonów w enwiromencie antagonalnym. Fakt ten-niestety-
                                                    ma o przełożenie na progresywny, acz nierównomierny wzrost wskaźnika kąśliwości.
                                                    Intensywne obijanie się plemnika o wewnętrze prezerwatywy, powoduje również
                                                    nadpłaszczenie łebka, co w konsewkwencji może doprowadzic do całkowitego
                                                    spłaszczenia Ziemi.Dobranoc.
                                                  • Gość: hermenegildo Re: Plemnik - agent IP: *.neoplus.adsl.tpnet.pl 20.02.07, 02:16
                                                    Czy wiecie, że zasadowe keratynopodobne białka histonowe plemników buhaja
                                                    składają się z 47 reszt aminokwasowych z alaniną jako N-końcowym oraz glutaminą
                                                    jako C-końcowym aminokwasem?
                                                    Założe się, że nie.
                                                    Zresztą zawsze możecie powiedzieć: a cóż to nas w ogóle obchodzi?
                                                    Niestety, nie zawsze tak jest. Przekonała się o tym mieszkanka Gryfic
                                                    (zachodniopomorskie) pani Mariola Sz. fatalnie obliczając współczynnik
                                                    penetrantu . Młodej mamie życzymy dużo zdrowia i cierpliwości......
                                                  • Gość: grypsio Re: Plemnik - agent IP: 80.51.122.* 20.02.07, 18:05
                                                    współczynnik
                                                    penetrantu:

                                                    - jak go zdefiniować?
                                                    Niechybnie jego wielkość jest wprost proporcjonalna do długości penetratora,
                                                    jak również do wskaźnika wilgotności powierzchni penetrowanej.
                                                    jednakże użycie tylko takich parametrów spłyca problem, mamy tu też masę
                                                    czynników niezależnych, że aż boję się napisać niemierzalnych (coś jak zasada
                                                    nieoznaczoności Haisenberga)
                                                  • Gość: hermenegildo Re: Plemnik - agent IP: *.neoplus.adsl.tpnet.pl 20.02.07, 18:40
                                                    Aha i jeszcze jedno.....Zależność opisująca zasadę nieoznaczoności dla energii
                                                    i czasu prowadzi do zaskakującego wniosku. Mechanika kwantowa pozwala na
                                                    pozorne złamanie zasady zachowania energii. Z nicości może wyłonić się
                                                    wirtualna cząstka, jeżeli po chwili ponownie zniknie. Proces ten nazywany jest
                                                    fluktuacją kwantową i zachodzi tak szybko, że nie jest dla nas zauważalny.
                                                    Zgodnie z mechaniką kwantową najdoskonalsza próżnia wypełniona jest oceanem
                                                    wirtualnych cząstek, które stale pojawiają się i znikają. W skali makro bilans
                                                    energetyczny wychodzi na zero, dzięki czemu zasada zachowania energii nie
                                                    zostanie złamana. Eksperymentalnie można zaobserwować istnienie wirtualnych
                                                    cząstek dzięki efektowi Casimira.
                                                  • Gość: aaa Re: Plemnik - agent IP: *.brnt.cable.ntl.com 20.02.07, 19:37
                                                    Z prawdziwym przerazeniem obsrwuje rozwoj tej, dyskusji, ktora pod plaszczykiem
                                                    naukowych teorii usiluje przemycic do powszechnej wiedzy stek- nie boje sie uzyc
                                                    tu drastycznego okreslenia- pseudonaukowych bzdur.
                                                    By nie byc gloslownym skypie sie zaledwie na kilku Waszych blednych opiniach:
                                                    1.Efekt Casimira (poprawnie Casiemira- pochodzil on bowiem z angielskiej linii
                                                    cesarskiej rodziny Orlahg von Schnappsengate. Nazwisko to na przestrzeni wiekow
                                                    ulego zanikowi natomiast czlonkow tej rodziny w skrocie nazywano cesarzami-
                                                    Kaiserami. Przez wieki owo nazwsko zmieniajac formy pisane i mowione, w koncu
                                                    utrawalilo sie w jedynie slusznej i prawidlowej pisowni jako Casiemir- podaje za
                                                    Europeans family root`s- Morrisa Morrisonsa, dostepne w British Library NW1 2FR)
                                                    2. Na temat spyderolazy ( z lac. spiderolasia spideriosum) istniej obszerne
                                                    opracowanie wybitnego wykladowcy Boston University of London, (-) Brahbariji
                                                    S(Silpy) Patrinjabisarhwiji, opublikowane zreszta w miedzynarodowym pismie
                                                    "Spiders evry day", nr 37 (456) z 18 lipca 2006 roku. Autor w zdecydowany sposob
                                                    rozprawia sie z teoriami jakoby reinkarnacja pajeczakow byla mozliwa. Podobnie
                                                    zdecydowanie rozprawia sie z pogladami przeciwnymi. Przeciwstawia im
                                                    skonstruowana, zbadana i udowodniona przez siebe teze o reinkarnacji
                                                    bezreinkarnacyjnej zwana takze bezreinkarnacja reinkarnacyjna.
                                                    Jesli zaistniej taka potrzeba jestem gotow skopiowac na potrzeby osob
                                                    dyskutujacych istotne fragmenty wspomnianej pracy ufajac, iz fakt, ze jest ona
                                                    napisana w jezyku urdu nie bedzie stanowil najmniejszego problemu dla szanownych
                                                    kolezanek i kolegow.
                                                    Pozostaje z naleznym szacunkiem.
                                                  • Gość: aaa Re: Plemnik - agent IP: *.brnt.cable.ntl.com 21.02.07, 01:15
                                                    Kolega hermenegildo popelnil blad, ktory bardzo czest przytrafia sie osobom
                                                    uwazajacym ,ze doskonale poznali wszelkie jezyki, by nie rzec pozjadali wszelkie
                                                    rozumy. Kolega byl uprzejmy zademnstrowac nam tekst we wchodniopusztunskiej
                                                    odmianie jezyka urbu, ktory rozni sie od jezyka urdu miedzy innymi- ze wspomne
                                                    tylko podstawowe roznice- fibrofoniczna wymowa dzwiekow garbnojezykowych oraz
                                                    dermioaudiacyjna fleksyjnoscia wytonow niskich. Rowniez jesli chodzi o forme
                                                    pisna tego jezyka to mamy tutaj doskonaly przyklad pomylenia idiowizyjnych
                                                    elementow diamorficznych ze edioboliczna arcela patela (linijki 8,11,12 i 17)
                                                    Przy okazji rzuca sie w oczy ,ze powyzszy teks jest dosc nieudolnym tlumaczeniem
                                                    ponizszego tekstu:
                                                    でおこなわれたポーラン
                                                    ドの市民がドイ式大使とし
                                                    てミールザー・アボルハサン
                                                    ・シーラーポーランドの市
                                                    民がド
                                                    イツの
                                                    Pozdrawiam
                                                  • jobrave Re: Plemnik - agent 21.02.07, 03:02
                                                    Oj figlarz z Ciebie, Zacny Hermenegildzie, bo nie wierzę, żeś pomylił ,że
                                                    pomylił wschodnio-pusztuńska odmianę urdu( której fragment łaskaw byłeś wkleić
                                                    do swojego postu), z typowo separtywnym morfologicznie chińskim pismem
                                                    hieroglificznym, ale cóż, dobry żart jak to mówią tynfa itd. Doceniam poczucie
                                                    humoru, szczególnie u ludzi nauki-nie możemy być przeciez ponurzy tylko dlatego,
                                                    że wiemy więcej od innych i więcej rozumiemy. Pozwolę sobie nawiązać, do niezbyt
                                                    wiolentnego ale jednak, sporu dotyczącego kosarzy, korsarzy i korsaży. Otóż,
                                                    jakkolowiek istnieje dość widoczna różnica pomiędzy p. kosarzem a korsarzem, tak
                                                    pomiedzy korsarzem a korsażem nie ma żadnej albowiem oba określenia sa właściwe
                                                    i używane w entomologii zamiennie a owo "rz" w jednej wersji i "ż" w drugiej
                                                    wynika z tego, że pierwotna nazwa pochodząca z języka francuskiego brzmiała: "le
                                                    corsage" jednakowoż w miarę upływu czasu zmieniała się przybierając znane
                                                    współcześnie - "le corsaire". Pająki korsarze (korsaże) powstały podczas rejsu
                                                    Ferdynanda Maggellana, jako rezultat słynnego stosunku płciowego słynnego
                                                    odkrywcy z siecią rybacką. Potomstwo Maggellna namnażało się niesłychanie
                                                    szybko, sajac się zagrożeniem dla marynarzy, w związku z tym,podjeto decyzję o
                                                    wyrzuceniu pająków za burtę. Nietrudno sobie wyobrazić, co stało się później,
                                                    otóż pozbawione ojcowskiej ręki owady, po otrząśnięciu się z objawów choroby
                                                    sierocej, zaczęły napadać na okręty a poniewż pierwszymi ofiarami pająków byli
                                                    francuscy marynarze, totez nic dziwnego, że własnie taka nazwa przylgnęła do
                                                    inkryminowanych owadów. Jeśli zaś chodzi o kosarze, to jest to gatunek, który
                                                    wyewoluował się z rośliny: kosaciec bródkowy (iris barbata) i proces trwał, jak
                                                    sięgam pamięcią ok. 250 mln lat. Trzeba jednak dokonać wreszcie studium
                                                    porównawczego pomiędzy korsarzem a kosarzem lub skonsultować się z lekarzem bądź
                                                    farmaceutą.
                                                  • Gość: bv Re: Plemnik - agent IP: *.ptvk.pl 21.02.07, 08:00
                                                    でおこなわれたポーラン
                                                    ドの市民がドイ式大使とし
                                                    てミールザー・アボルハサン
                                                    ・シーラーポーランドの市
                                                    民がド
                                                    イツの

                                                    Jestem zaskoczony, japoński język ! Jak robi się te znaczki?
                                                  • Gość: aaa Re: Plemnik - agent IP: *.brnt.cable.ntl.com 21.02.07, 10:39
                                                    Zastanawiam sie czy warto kontynuowac te dyskusje z osobami, ktore myla dwa
                                                    jezyki. Ja pisalem o wschodniopusztunskiej odmianie jezyka URBU.
                                                    Zdaje sobie sprawe, ze osoby ktorych kompetencje jezykowe nie siegaja zbyt
                                                    wysoko moga pomylic nazwy tych dwoch jezykow ale wybitny jezykoznawca, Profesor
                                                    Igor Stiepanowicz Wielolangwiczewskij wyraznie w swojej pracy ("Kak raznyje
                                                    ludiej, tak raznyje jazyki"- opublikowana przez Wydawnictwo Uniwersyteckie
                                                    Registanu, 1994) wskazal, iz mimo zbieznosci w nazwie, jezyki urdu i URBU nie
                                                    maja ze soba nic wspolnego.
                                                    Za owa wybitna prace naukowa, Profesor otrzymal dozywotnio Katedre Stosowanego i
                                                    Stosownego Jezyka Urbu na uniwersytecie Registanu.
                                                    Nic wiec dziwnego, ze koledze hermenegildowi wyszlo tlumaczenie jadlospisu. To
                                                    pewnie przez te ostatki.
                                                    Co do wypowiedzi na temat kosazy, korsarzy i pochodnych nawal obowiazkow nie
                                                    pozwala w tej chwili zaglebic mi sie w istote problemu (uczynie to najblizszej
                                                    wolnej chwili) nie mniej jednak pragnalbym tylko zwrocic uwage na zwiazek tej
                                                    nazwy ze staropolska kosba.
                                                    Pozostaje z naleznym szacunkiem.
                                                  • jobrave Re: Plemnik - agent 21.02.07, 11:47
                                                    Sprostowanie: Oczywiście pomyłka, chodziło mi, rzecz jasna, o "urbu" ale ten
                                                    błąd, przeinaczenie, jest w pewnym sensie projekcją podświadmości (lapsulogizm
                                                    subkonscienstualny) w kontekście idiosynkrazji na wszystko co pusztuńskie.
                                                    Interesująca jest propozycja kolegi "aaa"-naukowca z Wlk. Brytanii co,z właściwą
                                                    sobie ( jak i innym, równie wybitnym naukowcom) rozpoznałem po IP, dotycząca
                                                    poświęcenia nasze uwagi "kosbie", co prawda moja scientyczna przenikliwość każe
                                                    mi zastanowić się czy przypadkiem nie chodziło o "kośbę" (brak polskich fontów)
                                                    ale jeśli nawet, to uważam,że w kontekście trwającej obecnie lustracji, słowo
                                                    "kosba" jest bardziej wskazane , jako obiekt naukowych dociekań. Otóż w słowie
                                                    tym, ukrywa się nie tylko peerelowska tajna służba( "koSBa") lecz również
                                                    informacja na temat działalności kulturalno-oświatowej, którą SB, z nie zawsze
                                                    dobrym skutkiem, prowadziła (prefiks "KO"). Defektywny sufiks "a" z kolei jest z
                                                    kolei reliktologizmem pytania, tak więc gdybyśmy chcieli "przetłumaczyć" ów
                                                    wyraz, to wyglądałoby to tak: "a" co działalnością "k"ultrualno-"o"światową w
                                                    "SB"? Ot i tyle na razie, bo spieszę się na sympozjum.
                                                  • Gość: hermenegildo Re: Plemnik - agent IP: *.neoplus.adsl.tpnet.pl 21.02.07, 11:54
                                                    Ja jednak zadałem sobie trud i odnalazłem w pracy profesora Christiana
                                                    Skjoervensena z Uniwersytetu w Nuuk ostateczne rozstrzygnięcie dylematu -
                                                    korsarze czy kosarze (a może kosaże). Oto ono:
                                                    Nunarput, utoqqarsuanngoravit niaqqut ulissimavoqq qiinik.
                                                    Qitornatit kissumiaannarpatit tunillugit sineriavit piinik.
                                                    Akullequtaastut merletutut ilinni perotugut tamaani
                                                    kalaallinik imminik taajumavugut niaqquit ataqqinartup saani.
                                                    Atortillugillu tamaasa pisit ingerlaniarusuleqaagut,
                                                    nutarterlugillu noqitsigisatit siumut, siumut piumaqaagut.
                                                    Inersimalersut ingerlanerat tungaalitsiterusuleqaarput,
                                                    oqaatsit "aviisit" qanoq kingunerat atussasoq erinigileqaarput.
                                                    Taqilluni naami atunngiveqaaq, kalaallit siumut makigitsi.
                                                    Inuttut inuuneq pigiuminaqaaq, saperasi isumaqaleritsi.
                                                    I co Wy na to?
                                                  • Gość: grypsio Re: Plemnik - agent IP: 80.51.122.* 21.02.07, 18:02
                                                    Zacny i szacunku godny kolega: JOBRAVE niestety pomylił przysłowia -
                                                    abstrahujac od przedmiotu sporu - gdyż nie jest prawdą, że "ale cóż, dobry żart
                                                    jak to mówią tynfa". Wiadomym jest natomiast - co empirycznie zostało
                                                    udowodnione - że dobry żart TONFY wart. Tonfa jako pałka słuzbowa jest na
                                                    wyposażeniu Policji Państwowej i wcale nie chodzi o przekazanie tonfy przez
                                                    policjanta osobie opowiadajacej dowcip. Raczej - co ponownie stwierdzam po
                                                    empirii - chodzi o uzycie tejże TONFY na osobie opowiadajacej żart.

                                                    P>S>
                                                    wiem, że zbaczam z głównego tematu ale każda okoliczność poboczna również
                                                    wymaga pełnego wytłumaczenia
                                                  • Gość: jobrave Re: Plemnik - agent IP: *.centertel.pl 21.02.07, 19:40
                                                    Wielce Czcigodny Grypsio,
                                                    śpieszę wyjaśnić, że tu każdy temat jest główny ale pisząc o tonfie
                                                    (podświadomie lub nie) wcale nie odbiegłeś od głównego wątku, a dlaczego? Już
                                                    wyjaśniam. Otóż po usunięciu pająków z pokładu jednego okrętów maggelanowskiej
                                                    ekspedycji, zajęły się one korsarstwem; początkowo walczyły gołymi odnóżami ale
                                                    póżniej skonstatowały,iż bardziej efektywne będzie posługiwanie się jakąś
                                                    bronią. W owym czasie, w litoralu, rozgwiazdy oraz koniki morskie handlowały
                                                    pałkami typu tonfa, na wieść o tym pąjki spotkały się z przedstawicielem kartelu
                                                    "TONFA" CO. Ltd i zakupiły wspomniane pałki,natomiast jako ciekawostkę, dodam,
                                                    że pająki za ów towar płaciły tynfami, które podówczas były obowiązujacym
                                                    środkiem płatniczym w wodach oceanicznych i morskich.
                                                  • Gość: aaa Re: Plemnik - agent IP: *.brnt.cable.ntl.com 21.02.07, 19:59
                                                    Odpowiadajac hermenegildowi: oczywiscie, ze mozna wierzy. Misisz wszakze wziac
                                                    pod uwage, ze nie tylko naukowcy tutaj pisza i trzebac dac szanse innym,
                                                    nienaukowcom, by mogli sprawdzic u zrodel.
                                                    Pozwol, ze co do meritum wypowiem sie pozniej, jako ze w chwili obecnej
                                                    niezwykle zajetym pewna dysertacja , mlodego, dobrze zapowiadajacego sie
                                                    naukowca, protegowanego mi zreszta przez wspomnianegi tu juz profesora
                                                  • Gość: hermenegildo Re: Plemnik - agent IP: *.neoplus.adsl.tpnet.pl 24.02.07, 02:04

                                                    "Aruru stworzyła z gliny i "rzuciła w step" Enkidu, włochatego giganta, który
                                                    przypominał dzikie zwierzę. Enkidu zamieszkał na stepie wraz z żyjącymi na nim
                                                    zwierzętami. O jego istnieniu dowiedział się myśliwy, któremu Enkidu niweczył
                                                    pracę, uwalniając schwytane zwierzęta i niszcząc zastawiane sidła. Myśliwy udał
                                                    się po pomoc do Gilgamesza. Ten wysłał na step prostytutkę Szamchat z zadaniem
                                                    uwiedzenia i "ucywilizowania" Enkidu. Kurtyzana sprawiła się doskonale i
                                                    sprowadziła zakochanego w niej Enkidu do Uruk. Tam włochaty olbrzym nauczył się
                                                    kąpać, perfumować, stroić oraz ucztować. Pewnego dnia, gdy dowiedział się, że
                                                    Gilgamesz znowu chce spędzić noc z nowo poślubioną panną, zastąpił władcy Uruk
                                                    drogę. Doszło do długotrwałej, nierozstrzygniętej walki wręcz, po której obaj
                                                    siłacze zaprzyjaźnili się."
                                                    Nie należy zatem tracić nadziei:-)
            • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 05.03.07, 02:35
              Z tego też powodu, mialem wielokrotnie rozcinane podbrzusze i obecnie, prawdę
              mówiąc, już go nie mam lecz protezę podbrzusza, wykonaną przez szamana
              nadamazońskiego plemienia Uyjii- Butaija, po polsku znaczy to:"Mongolski
              Kangur".Otóż Butaija wykonał ową protezę ze śliny, dodając do niej, w dużych
              ilościach kaolin i węgiel brunatny oraz pazur nietoperza. Uszkodzone jelita
              szaman zastapił po części jelitami kapibary a po części fragmentem okrężnicy z
              niedojedzonego wojownika z plemienia wrogiego Uyijom, bodajże Kamuhi.
              Niemniej groźne są kolibry tytoniowe (tochilus nicotiana tabacum), które
              występują w brazylijskich papierosach bez filtra. Wnikają do układu oddechowego
              wraz z dymem a już będąc w płucach,żywią pęcherzykami płucnymi rozrastajac się
              do rozmiarów właściwym włócznikom modroczelnym (Doryfera johannae) organiczając
              wydolność spiromatyczną nawet do zera, co skutkuje śmiercią. Jedynym ratunkiem
              jest szybka interwencja chirurga lub natychmiastowe podanie choremu trzech wąsów
              wyrwanych jaguarowi podczas snu.
              • Gość: hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.neoplus.adsl.tpnet.pl 05.03.07, 11:01
                Można tu jeszcze tylko dodać, że po raz pierwszy kolibry tytoniowe mogliśmy
                oglądać w naszym kraju podczas emisji doskonałego serialu "Quando Isaura estaba
                enferma". Ponadto pracownicy brazylijskiej sekcji "National Geographic" w
                Manaus stwierdzili zupełnie przypadkowo ogromnie zwiększoną aktywność osobników
                gatunku Doryfera johannae podczas tropikalnych deszczów, co wynika zapewne z
                konieczności częstego zwilżania ich skrzydeł. Niemniej przypadki tzw.
                kolibrzycy płucnej (trochiliosis pulmonum)stanowią w regionie czwartą przyczynę
                zgonów. To stąd właśnie pochodzą pierwsze ostrzeżenia palaczy drukowane obecnie
                na wszystkich paczkach papierosów.
                  • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 07.03.07, 17:38
                    Czy chodzi o poważne przemyślenia na temat kolibrzycy czy przemyślenia w ogóle?
                    Z prof. Hermenegildo skoncentrowalismy się na kolibrzycy, ponieważ, w zw.
                    zagrożeniem globalnego ocieplenia, również i -w zamieszkiwanym przez nas
                    rejonie- mogą pojawić się kolibry tytoniowe-a to, determinuje już bardzo powazne
                    problemy społeczne. Oczywiście wolałbym się poświęcić filozofii i dokończyć,
                    chociażby niedawno rozpoczętą pracę pt. "Dualizm monizmu czy monizm dualizmu?"
                    ale nawarstwiająće się problemy społeczne pchają mnie multi- i inter-
                    dyscyplinarne, podobnie rzecz się ma-jak sądzę-z moim interlokutorem prof.
                    Hermenegildo.
                    Jesteś Pan zapewne, Panie Pedro Paulo, pięknoduchem, nurzającym się, jak
                    niegdyś i ja, w abstrakcji ale misją naukowca jest równiez działanie, na rzecz
                    społeczeństwa, w sposób bardziej konkretny, i my to czynimy. Czy zdaje Pan sobie
                    sprawe z tego, że wśród koników szachowych pojawiła się choroba o nieznanej
                    etiologi, która powoduje tiki nerwowe i chorobe wibracyjną i u cieśli, stolarzy,
                    ślusarzy i nauczycieli? Czy ma Pan świadomość, że unoszące się w atmosferze
                    związki kadmu osłabiają genetyczne bariery międzygatunkowe, przez co dojść moze
                    niebawem do, niekontrolowanego, powstawania gatunków hybrydalnych np. psa z
                    trąbą albo stunożnej stonki ziemczanej? A czy zastanawia się Pan nad tym jakie
                    skutki może mieć legalizacja związków sodomistycznych (zoofilnych)? Przyjdzie
                    czas, że za filozofię wezmę się również
                    • Gość: hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.neoplus.adsl.tpnet.pl 08.03.07, 02:04
                      Filozofia czy zoofilia?
                      Ten problem istnieje od dawna i unikanie go w poważnych dysputach niczego
                      dobrego nam nie przyniesie. Zauważmy, że już Gorgiasz z Leontinoi stanowczo
                      twierdził, że nic nie istnieje, a gdyby nawet istniało - nie dałoby się w żaden
                      sensowny sposób wyjaśnić. Nihilizm tego stwierdzenia jest doprawdy
                      zniewalający. Ale ja w swoich dociekaniach posunąłem się jeszcze dalej i
                      postawiłem moim studentom proste pytanie: czy istnieje antypróżnia? Jeśli tak
                      to z czego ewewntualnie mogłaby być zbudowana?
                      I tutaj młody indyjski doktorant Shrimavi Bthath wystąpił z ciekawą koncepcją,
                      że przecież przeciwieństwem braku czegoś jest coś (a zatem materia)! Niestety
                      koherentność tej teorii ma swoją słabą stronę albowiem próżnia z kolei nie jest
                      antymaterią.
                      Na koniec chciałbym odnieść się do niesłychanie ważnej kwestii legalizacji
                      związków zoofilnych. Oczywiście to dobry pomysł, choć dosyć śmiały jak na
                      dzisiejsze czasy. Biologia odnosi duże korzyści jeśli materiał genetyczny jest
                      maksymalnie heterogenny. Wszyscy wiemy (no może wszyscy), dlaczego zakazane
                      jest kazirodztwo oraz dlaczego wśród psów najdłużej statystycznie żyją kundle.
                      Powoduje to właśnie obecność represorów dla genów kodujących różne
                      nieprawidłowości. Pytanie zatem brzmi nie czy to zrobić ale jak? Jak
                      zalegalizować np. swój związek ze stułbią, w jakim żyć środowisku, no i co z
                      adopcją?
    • Gość: Tik - Tak Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.mcon.pl 08.03.07, 12:51
      Nic sobie do niczego nie uzurpuję, ale pomysł z tym wątkiem to był mój.I co z
      tego powie na to ktoś.Ano nic tylko komu i czemu ma on obecnie służyć
      (wątek).Ty, szanowny Hermenegildo, jak i Ty Jobrave szlachetny mniej
      wykorzystujcie swoją wiedzę i coś tam jeszcze(trudno mi było napisać CO w Was
      tkwi, ja wiem, a inni się obruszą)i załóżcie watek o poprawnej pisowni, o
      gramatyce, o ortografii, o interpunkcji, o kanonach pisania przedniego tekstu
      itd.Byłby taki wątek pozytecznym w sensie edukacyjnym dla mnie i dla niewielu(a
      moze wielu jednak).Przemyślcie to, bo jak widać nikt nie dopisuje, a wręcz
      przeciwnie, buntują sie.Do dzieła.Założę ten wątek.Na przykład....
            • Gość: aaa Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.brnt.cable.ntl.com 08.03.07, 18:20
              Och, no nie dopisuje sie do watku, gdyz niezwykle wazne sprawy natury naukowej
              nie pozwalaja mi na biezace dopisywanie sie do watku, niemniej jednak z wielka
              uwaga i zainteresowaniem sledze jego rozwoj.
              Wspomne tylko ,ze obecnie jestm w trakcie obserwacji niezwykle ciekawego
              zjawiska, jakim jest cykl rozwojowy jednegp z pajeczakow. Okaz ow zostal
              przywieziony do naszego lavboratorium z Kuby i juz po krotkiej obserwacji moge
              stwierdzic, ze jest niezwykle waznym ogniwem w rozwoju wspomnianego juz tutaj,
              kolibra tytoniowego a dokladniej rodziny kolibrow cygarniczych. Pozdrawiam
              • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 08.03.07, 20:17
                Drogi Tik-Taku, przyznam , żeś zdeprymował mnie trochę tą ostentacyjną
                demonstracją swojej niechęci, do wątku którego jesteś inspiratorem a ja
                entuzjastycznym założycielem. Chciałbyś przerwać coś, co zaowocowało nie tylko
                wiekopomnymi odkryciami w sferze nauki ale również unicestwić wysoki,
                merytoryczny poziom dyskusji. Zechciej tez zauważyć, iż jest to jedyny wątek na
                tym forum, w którym dyskutanci nie obrzucają się obelgami i odnoszą się do
                siebie z szacunkiem (choć widzę,że już próbujesz intrygować nazywając mnie
                osobnikiem "mniej szlachetnym",od jednego z moich znakomitych współdyskutantów,
                prof. Hermenegildo).
                Twój pomysł dotyczacy powołania wątku "językowego" jest bardzo dobry ale
                obaiwam się, że jego ewentualni uczestnicy, którzy zamieszczą w nim swoje uwagi,
                pouczenia itp. spotkają się ze zmasowanym i solidarnym atakiem różnej maści
                frustratów, nie mogących znieść tego, że ktoś ośmiela się ich pouczać, wykazywać
                błędy itp. Drażnią mnie one, podobnie jak Ciebie ale nie wytykam ich, bo sam je
                popełniam a, ponadto są tu-na tym forum- ludzie, których darzę sympatią i jakos
                tak głupio się wymądrzać. Końcem końców uważam, że wątek ten należy kontunowac
                zarówno ze względu na nas i jak i-przede wszystkim dla dobra ludzkości. wyrażam
                też ubolewanie, iż zaniechałeś badań nad pająkiem kosarzem, a szkoda, bo w tym
                czasie zespół peruwiańskich arachologów odkrył gen dzięki , któremu kosarze nie
                maja żadnych problemów z przyswajaniem języka estońskiego.
                • Gość: hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.neoplus.adsl.tpnet.pl 09.03.07, 00:21
                  Prof.Eduardo Martinez sin Cojones z Instytutu Genetyki Uniwersytetu w Limie
                  odkrył nieznaną dotąd sekwencję nukleotydów GGACTTAGTAATTAGGTGATGATT kodującą
                  oktapeptyd arachnilidynę występującą wyłącznie u kosarzy (zwanych zresztą w
                  języku estońskim hämähäkkieläimiin).
                  To odkrycie było w zasadzie kwestią czasu, od dawna już bowiem genetycy
                  skłaniali się do twierdzenia iż regułą jest, że komórki kodują białka ulegające
                  najszybszej translacji przy pomocy kodonów rozpoznawanych przez najliczniejsze
                  warianty izoakceptorowego tRNA.
                  Okazało się, że te fragmenty tRNA są bardzo podobne do języka estońskiego, za
                  pomocą restryktaz wklejono je do genomu kosarza i co zdumiewające kosarze z
                  Limy bez problemu wykręcały kierunkowy do Tallinna prowadząc swobodną
                  konwersację....
                        • Gość: hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.neoplus.adsl.tpnet.pl 11.03.07, 01:45
                          "Constient ca nu are nici o sansa sa cistige fotoliul de primar al
                          Bucurestiului, PSD vrea, prin numirea lui Vlad Dumitrescu, sa dea un semnal
                          politic electo-ratului, acela ca nu are nici o retinere in a promova tineri".
                          P.S.Tęgoryjce nie mówią "po naszymu" , nie jest znany ani jeden taki przypadek.
                          Wiem to od znajomej kapibary, która regularnie dzwoni mi na komórkę (nie wiem,
                          chyba chce poplotkować).
                          "Fuck the cola, fuck the pizza, all we need is sljivovitza!" - napis na murze w
                          Sarajewie.
                          • Gość: explainer Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.neoplus.adsl.tpnet.pl 13.03.07, 02:19
                            W oddziaływaniach silnych uczestniczą cząstki obdarzone ładunkiem kolorowym,
                            bądź zbudowane z takich cząstek. Ruchy i przemiany tych cząstek tłumaczy się
                            wymianą bozonów zwanych gluonami. Fermiony obdarzone ładunkiem kolorowym zwane
                            są kwarkami. Znamy sześć kwarków i sześć antykwarków.

                            Istnieją trzy ładunki kolorowe: czerwony, zielony i niebieski oraz trzy
                            ładunki, którymi obdarzone są antykwarki: antyczerwony, antyzielony i
                            antyniebieski. Ponieważ nigdy nie zaobserwowano swobodnej cząstki naładowanej
                            kolorowo, powstała hipoteza głosząca, że swobodne mogą być jedynie cząstki
                            kolorowo neutralne (białe). Nazywa się ją hipotezą uwięzienia kwarków.
                            Chromodynamika tłumaczy to w ten sposób, że siła przyciągania między kwarkami
                            rośnie wraz ze zwiększaniem odległości.

                            Chociaż każdy kwark posiada kolor, to jednak wciąż zmienia go poprzez wymianę
                            gluonów. Z tego powodu niemożliwe jest określenie koloru kwarku w danej chwili,
                            a każdy stan kwarku (o określonym ładunku i masie) o dowolnym kolorze uważa się
                            za tę samą cząstkę (dlatego mamy sześć a nie osiemnaście kwarków).

                            • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 13.03.07, 15:55
                              I byłoby wszystko znakomicie, gdyby nie prof.dr. Bumboo Ombwijoombo,znany
                              kenijski fizyk z Nairobi University, twierdzi on mianowicie, że istnieję spisek
                              białych naukowców, którzy postanowili zataić istnienie czarnych kwarków. Prof.
                              Ombwijoombo, traktuje to jako przejaw dyskryminacji rasowej, ponieważ uważa, że
                              wszystkie kwarki są równe a czarne nawet bardziej. Jak poinformował rzecznik
                              prasowy Nairobi University, dr Bughanga Mbawileluthanga, w najbliższm czasie
                              Trybunał Międzynarodowy przy ONZ rozpatrzy sprawę dyskryminacji kwarków. O tym,
                              że autor pozwu nie przebierał w słowach, niech świadczy , chociażby, to jedno
                              zdanie:
                              "(...)A tija bambooku imbemm kwarkele abubu umbwele, tele, wawele patongo."
                              Ostre, ostre to, trzeba przyznać.
                              • Gość: hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.neoplus.adsl.tpnet.pl 13.03.07, 21:04
                                Ha!
                                Wreszcie ktoś poruszył tę sprawę. Dodam, że swego czasu była ona komentowana na
                                łamach "New Journal of Physics" bodajże 3 lata temu....
                                Profesora Ombwijoombo poznałem na przyjęciu w ambasadzie Norwegii w Nairobi pod
                                koniec listopada 2002 r. Okazało się, że zdanie "A tija bambooku imbemm
                                kwarkele abubu umbwele, tele, wawele patongo" zostało wyrwane z kontekstu przez
                                słabo znających narzecze kjunguja (wywodzące się zresztą z Zanzibaru)
                                dziennikarzy. W rzeczywistości profesor powiedział: "naweza kupata wapi
                                kinywaji?" co w kiswahili oznacza - czy mogę się czegoś napić.
                                Dorabianie złych intencji naukowcom afrykańskim, a także co gorsza wykradanie
                                im cennych cytatów ( to właśnie dr Bughanga Mbawileluthanga jest autorem
                                twierdzenia, iż nic nas nie przekona, że czarne jest czarne, a białe jest białe)
                                staje się ostatnio signum temporis całej anglojęzycznej żurnalistyki.
                                Wyobraźcie sobie , że w suahili wyrażenie "Elfu moja barabara" oznacza po
                                prostu tysiąc dróg, a ja już widzę te Wasze uśmieszki.......
                                • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 14.03.07, 02:34
                                  no a ja, jak zwykle o czyms zapomniałem,mianowicie o tym , ze nasz czarnoskóry
                                  kolega jest autorem "Teorii niewidzialnych s-kwarków". Co do wypowiedzi
                                  profesora i rzecznika, przyznam , że nie słuchałem zbyt uważnie, bo akurat
                                  wyduszałem wągry(comedomes derma) z pleców jego żonie.
                                  • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 15.03.07, 01:13
                                    No jasne, każdy by tak chciał. Jeśli będziemy się z byle powodu rozpraszać to
                                    co z naszą misją edukacyjną? Ludzie, którzy wpadają tu dowiedzieć się o
                                    rzeczach, których nie znajdą w żadnej encyklopedii świata mogą poczuć się
                                    dotknięci, a tego chyba nie chcemy.
                                    Ale oczywiście możemy pójść na skróty i taką śmiałą koncepcję chcę niniejszym
                                    zaproponować.
                                    Ten wątek bezapelacyjnie kończymy i zakładamy następny, zaczynający się od
                                    słów: "Dlaczego w Przemyślu ( wpisujemy cokolwiek..... )?
                                    Sprawdziłem z deszczem, słabo ale działa....
                                    • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 15.03.07, 02:05
                                      Twoja propozycja jest słuszna ale musze sie też wytłumaczyć: otóż ja te wągry z
                                      pleców żony profesora wyduszałem dla dobra nauki, bo wyobraż sobie, że poddajac
                                      je obróbce termicznej na patelni wykonanej ze spieku irydowo-tytanowego,
                                      otrzymałem s-kwarki widzialne, które można- jak się okazało-wykorzystać w
                                      technologii żywienia. Właśnie na nich usmażyłem jajecznicę z jaja strusia nandu.
                                      Odkrycie to, może w znacznym stopniu zaradzić pladze głodu dręczącej większość
                                      krajów Czarnego Lądu. Wągry, inaczej zaskórniaki, występują na skórze niemal
                                      każdego, czarnoskórego mieszkańca Afryki. Pozwoliłem sobie przeprowadzić szereg
                                      badań majacych na celu ustalenie składu chemicznego tamtejszych wągrów i
                                      oniemiałem! Cóż to za rezerwuar witamim, mikroelemntów i innych niezbędnych do
                                      życia skłądników. Czegóż tam nie ma, pomijam już pospolite białko ale w 100 j.
                                      wągra zanjduje się 130 j. kwasów omega-3 !!!!! Wszystkie witaminy i wszystkie
                                      pierwiastki jak również aspiryna i proszek do prania!!! Ale nic to, zgadzam się
                                      , z naszą misją edukacyjną-oczywiście nadal niestety na poziomie
                                      popularyztarskim- wyjśc musimy na szersze forum ale nie likwidujac tego wątku,
                                      ponieważ może być on i, swego rodzaju azylem i zapleczem naukowym. Natomiast-jak
                                      sądzę, dobrym pomysłem będzie nie tylko, proponowane przez Ciebie tworzenie
                                      nowych wątków ale i zaszczepianie wirusem nauki wątków juz istniejących, o
                                      charekterze społeczno-politycznym, wyłączyłbym natomiast wątki dotyczące
                                      problematyki społeczno-gospodarczej, gdyż tam dyskutanci nie potrzebują aż tak
                                      bardzo łatania lik w edukacji. Teraz spieszę założy
                                      c nowy wątek.
                                      • cfaniaczka Re: Nowy,intrygujący,pasjonujący i trudny wątek 15.03.07, 23:46
                                        Jobrave, zbyt szybko kapitulujesz , ten Hermenegild ( tak mi pasuje bardziej ,
                                        zgadzasz sie Hermenegildzie?) ma nad Tobą jakis transcendentalny wpływ, który
                                        polega na sterowaniu działaniami zmierzającymi do dookreślonego celu, mimo, że
                                        ów cel nie jest, a w każdym razie nie musi być uświadomiony, mozliwe, ze
                                        wypływa on z najzwyczajniejszej nudyyyyyy wszechobecnej w ekosystemach
                                        jednopłciowych.
                          • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 20.03.07, 03:17
                            formacja hipokampa → sklepienie → ciało suteczkowate → pęczek suteczkowo-
                            wzgórzowy → jądro przednie wzgórza → odnoga przednia torebki wewnętrznej →
                            zakręt obręczy → zakręt hipokampa → droga przeszywająca → formacja hipokampa.
                            A zatem wypić i zapomnieć zanim pamięć stanie sie białkiem.

                            • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 21.03.07, 02:46
                              Boję się Tik-Taku czy aby nie sa to początki rzadkiej acz niebezpiecznej
                              choroby, o nie znanej jeszcze etiologi, zwanej akacjoliozą liczydłową
                              (accaciolisis abacusis), pierwsze objawy przypominają nerwicę anankastyczną ze
                              względu na obsesjonalna wręcz potrzebę odrywania listków akcji od gałązki ( nie
                              oznancza to,że tylko z akcja ma związek owa jednostka chorobowa). Jak już
                              wspomniałem etiologia jest nieznana ale mam pewne podjerzenia, które nasunęły mi
                              się podczas sekcji zwłok mikroskopijnego pająka akcjowego (araneae accacius),
                              który jest tak mały, że jego wymiary mają wartość ujmną a więc mniejszą od zera,
                              podbnie zresztą rzecz ma się z jego wagą. Ze zrywanych przez Ciebie liści akcji
                              pająki bez żadnych trudności przechodzą przez pory skóry do krwioobiegu a
                              później już swobodnie razem krwią do mózgu a tym samym do hipokampu, po
                              akomodacji, która z reguły trwa nie więcej , niż trzy dni pajaki sa juz
                              zadmowione, do tego stopnia, że otwierają tam własne sklepy, kawiarnie,
                              cukiernie, fabryki garnków stalowych, kopalnie kwarcytów i zakłady rybne.
                              Nietety nie odbywa się to bez szkody dla żywiciela. I co Ci więcej będę mówił.
                              • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 22.03.07, 00:30
                                Jeśli żywiciel dostaje za to wszystko faktury to rzeczywiście nie ma się co
                                dziwić. Kiedyś myślano, że tak małe pająki mogą wywoływać akalkulię (są
                                mianowicie doskonale rozpuszczalne w tłuszczach i znakomicie penetrują przez
                                barierę krew - mózg), ale późniejsze badania tego nie potwierdziły (podobnie
                                jak fakt, iż to nie agrafki wywołują agrafię).
                                Jako ciekawostkę można przytoczyć fakt, że te małe pajęczaki zwykle cierpią na
                                keraunofobię dlatego też objawy akacjoliozy liczydłowej znikają podczas silnych
                                burz.
                                • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 22.03.07, 01:33
                                  Pozwolę sobie zgodzic się jedynie ze stwierdzeniem, iż to "agrafki nie wywołują
                                  agrafii". Istotnie tak jest, natomiast jeśli chodzi o AGRAWIĘ, to wywołują ją
                                  AGRAWKI (agraavo agraavis). Na ślad agrawek wpadł w IV wieku p.n.e.
                                  Halucynogenus Młodszy (nb. intersująca sprawa, bo niby przydomek "młodszy"
                                  warunkowałby istnienie Halucynogenusa Starszego, tymczasem nic z tych rzeczy
                                  starszego po prostu nie było-to zreszta temat na osobną dyskusję). Otóż po
                                  wypiciu dwóch solidnych amfor niezbyt doskonałego wina, Halucynogenus Młodszy
                                  zasnął na jednej z plaż w okolicach dzisiejszego Pireusu, w trakcie snu dopadła
                                  go padaczka alkoholowa, w wyniku której, odpięła się zapinka spinająca, zbyt
                                  luźny, chiton i zniknęła w piasku. Próbował ją wykorzystać, w charakterze laski
                                  ortopedycznej, włóczący się po plaży, kulejący homar. Zapinka wbiła mu się pod
                                  pachę, w miejscu, w którym akurat znajdował się węzeł chłonny. Z wbitą zapinką
                                  homar przypadkiem trafił na śpiącego Halucynogenusa, zdążył jeszcze zapalić
                                  egipskiego papierosa "sfinks", po czym wyzionął ducha na piersi Halucynogenusa,
                                  dokładnie w tym miejscu, gdzie wcześniej znajdowała się zapinka. Halucynogenus
                                  otrzeźwiał i sądząc, iż to zapinka lezy na jego piersi, postanowił ją dopiąć i
                                  wówczas ukłuł się w palce zarówno zapinką jak i wyrostkiem strzemiączkowym
                                  bocznym homara, co w konsekwencji wywołało agrawię. Poczatki choroby objawiaja
                                  sie u pacjenta, nieprzemożną wręcz ochotą do pisania książek telefonicznych a
                                  notmiast w końcowym stadium, chory zajmuje się hodowlą kur zielononóżek i
                                  obserwacja pierścieni Saturna.
                                  • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 22.03.07, 10:26
                                    Wg ostatnich badań niemieckiego filologa F.A.Wolfa, okazuje się, że to nie
                                    homar przechodził wówczas plażą w Pireusie tylko Homer! Cytuję istotny fragment:
                                    "Śmierć Homera owiana jest legendą; wyrocznia delficka przestrzegała go przed
                                    zagadkami chłopców. Pewnego dnia, przechadzając się po plaży, zapytał
                                    rybaków "Jak się wam udała wyprawa?", najmłodszy z nich odpowiedział mu na
                                    to: "Wszystko cośmy schwytali zostawiliśmy w morzu; wszystko czegośmy nie
                                    schwytali, przywozimy do domu". Homer przypomniał sobie właśnie wtedy słowa
                                    owej wyroczni, i nie mogąc zrozumieć ich słów, pojął, iż nadszedł kres jego
                                    życia, i umarł, według opowieści na trzeci dzień. Rybacy zaś mówili o pchłach.
                                    Schwytane na ubraniu wrzucali do morza, te zaś których nie złapali, przywieźli
                                    ze sobą do domu. (Użyto fragmentów "Słownika mitów i tradycji kultury" W.
                                    Kopalińskiego)".
                                    Obsesja pisania książek telefonicznych jest dość popularnym objawem chorobowym
                                    szczególnie często występujacym wśród pracowników TPSA i jako taka nie wymaga
                                    leczenia, a jedynie obserwacji. Jeśli dołączy się do niej nieprzemożna chęć
                                    hodowli kur zielononóżek kuropatwianych (lub chociaż tylko zwiedzania doliny
                                    Baryczy),osoby takie są natychmiast zwalniane z pracy. W przypadku obserwacji
                                    pierścieni Saturna zalecane są elektrowstrząsy i śpiączki atropinowe.

                                    • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 25.03.07, 23:48
                                      No cóż, a ja ostatnio odszedłem trochę od nauki i poświeciłem się prostym ale
                                      użytecznym wynalazkom. Udało mi się wyprodukować szybę, którą można rozbić tylko
                                      z jednej strony, a w procesie reedestylacji alkoholu (nie mylic z redestylacja,
                                      która jest zupełnie innym procesem) sukcesem zakończyło się uzyskanie produktów,
                                      z których alkhol uzyskano. I tu wpadłem na trop szalbierstw: podczas
                                      reedestylacji dwóch litrów whisky "Bell's" zamiast jęczmienia, wody i drożdzy z
                                      rury posypały sie nadgniłe kartogofle i wysłodki buraczane, reedestylując wódkę
                                      żytnią -uzyskałem niedojedzone kaczany kukurydzy, pół porcji mizerii, pięć
                                      jabłkowych ogryzków, dwie martwe myszy, miotłę brzozową i opakowanie po
                                      szczypcach do bielizny.
                                      • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 26.03.07, 00:54
                                        Silnik z pozycji nr 8407, dla którego reguła stanowi, że wartość materiałów
                                        niepochodzących, które mogą być włączone, nie może przekraczać 40% ceny ex
                                        works, jest wykonany z "innej stali stopowej z grubsza ukształtowanej przez
                                        kucie" z pozycji nr ex 7224.

                                        Jeżeli ta odkuwka została wykonana w Turcji, z niepochodzącej wlewki, to
                                        odkuwka nabyła już status pochodzenia w oparciu o regułę dotyczącą pozycji nr
                                        ex 7224 w wykazie. Może ona potem być liczona jako pochodząca przy obliczaniu
                                        wartości silnika, niezależnie od tego, czy został on wyprodukowany w tej samej
                                        fabryce czy w innej fabryce w Turcji. Wartość niepochodzącej wlewki nie jest
                                        więc brana pod uwagę przy sumowaniu wartości użytych materiałów niepochodzących.

                                        Oczywiście należy rozumieć, że e-destylacja to destylacja za pomocą komputera,
                                        natomiast re-e-destylacja to e-destylacja z rekontrą po partii!
                                            • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 29.03.07, 18:15
                                              Merci, że jestes znów Tik-Tak, choc z charakteru twojego pisma wynika, że uraza
                                              jaką żywiłeś (żywisz) do Hermenegildo jeszcze nie całkiem przeszła. Ale nic to,
                                              śpieszę donieść, że dzięki mnie i mojemu rosyjskiemu przyjacielowi Wsiewołodowi
                                              Arsniejewiczowi Wieloszczetowowi, kandydatowi wszechnauk Rosyjskiej Akademii
                                              Naukowej spwodowaliśmy zniknięcie z naszego globu barbarzyńskiego zjawiska,
                                              jakim niewątpliwie jest kanibalizm.
                                              Od pewnego czasu dochodziły nas słuchy, że na jednej z niewielkich wysp u
                                              wybrzeży Papui=Nowej Nowej Gwinei, tamtejsi tambylcy, z plemienia Ti-Tuo-Ti,
                                              zjadają nie tylko swoich wrogów ale również swoich pobratymców. Postanowiliśmy
                                              sprawdzic prawdziwośc owych sygnałów i nie zastanwiając się długo
                                              zaokrętowaliśmy się na "Dar Darczyńców", którym dopołynęłiśmy do wyspy
                                              Kuap-Kuap. Tambylcy tak zasmakowali w ludzkim mięsie, że z braku mięsa wrażego,
                                              jak również braku osobników niedołężnych i dzieci, zaczęli zjadać siebie. Oczom
                                              moim ukazał się niesamowity, mrożący krew w żyłach, widok: oto syn wodza
                                              plemienia, niespełna 20.letni Muri-Mora odciął sobie rękę i położył ją na
                                              grillu, zamierzał to samo zrobić z drugą ale nie miał juz prawej ręki więc, nie
                                              mógł tego uczynić. Z nadzieją popatrzył na nas. Mój przyjaciel Wsiewołod,
                                              niewiele myśląc, zręcznie wskoczył do szalupy skąd wyniósł nienajnowszą co
                                              prawda ale solidną piłę motorową "Kirowgrad 3" i po chwili Muri-Mora zajadał się
                                              swoimi chrupiacymi rękami i odnóżami, namawiąjąc nas szczerze abyśmy również
                                              przystąpili do posiłku. Przyznaję, że nie daliśmy się prosić zbyt długo,
                                              ponieważ byliśmy bardzo głodni - nasz kucharz, Charles III Tudor, jest Anglikiem
                                              i bez przerwy serwował nam placki owsiane z sosem miętowym, toteż z wielką
                                              ochotą zmieniliśmy menu na wysoko białkowe. W pewnej chwili Muri-Mora zaczął cos
                                              mówić o mięsie białego człowieka, spoglądając przy tym pożądliwie na mój biceps
                                              ale mój rosyjski przyjaciel znów popisał się niebywałym refleksem - uniósł z
                                              ziemi swoja niezwodną "Kirowgrad 3" i po chwili, głowa amatora białego mięsa
                                              znalazła się wśród otaczającej nas gawiedzi. W ciągu dwóch dni pomogliśmy
                                              tambylcom zjeść samych siebie, natomiast, tym co pozostało, podzielilismy się
                                              tamtejszymi szakalami, hienami i sępami. Kiedy udawaliśmy sie juz spowrotem na
                                              "Dar Darczyńców" , do brzegu dobijała właśnie ekipa "National Geographic".
                                              Zapytali czy mają szansę napotkać, tu jeszcze ludożerców? zgodnie z prawdą
                                              odpwiedzilismy im, że nie, ponieważ własnie wczoraj zjedliśmy ostatnich.
                                                • Gość: cfaniaczka Re: Nowy,intrygujący,pasjonujący i trudny wątek IP: *.neoplus.adsl.tpnet.pl 02.04.07, 20:52
                                                  He he, grunt to prawidłowa samoocena Tik Taku, ja , Cfaniaczka naprawdę fcale
                                                  się Ciebie nie czepiam, jedynie jestem pod wrażeniem wrodzonej (zapewne)
                                                  surowości i autosurowości ( musze pogrzebać, na pewno Freud cos o tym pisał ,
                                                  normalnie niedouczona cfaniaczka jestem !). Kurczę, szkoda że okres
                                                  przedświateczny bo dużo materiału badawczego postrzegam......mniam mniam,
                                                  drżyjcie, będzie bolało , ale ...poświęćmy sie dla nauki !
                                                  Na razie zawieszę firanki, proza życia.
                                                  Wesołych !
                                              • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 29.03.07, 22:13
                                                "Kuru, popularnie "śmiejąca się śmierć" (ang. curu, kuru; nazwa od czasownika
                                                drżeć w jezyku plemienia Fore) - zawsze śmiertelna choroba zakaźna wywoływana
                                                przez priony.
                                                Do zakażenia dochodziło u dopuszczających się kanibalizmu członków plemienia
                                                Fore zamieszkującego Góry Wschodnie Papui Nowej Gwinei. Czynnik patogenny
                                                miałby przenikać przez skórę i spojówki, w wyniku rytualnego nacierania twarzy
                                                ludzkimi mózgami (głównie przez kobiety i dzieci). Po około 20. latach
                                                inkubacji pojawiały się pierwsze objawy.
                                                Kuru to pierwsza opisana u ludzi zakaźna encefalopatia gąbczasta. Choroba ta
                                                przestała występować po 1959 roku, kiedy plemię zaprzestało kanibalizmu.
                                                W okresie prodromalnym choroby pojawiają się bóle głowy, brzucha i kończyn,
                                                zwłaszcza stawów. Może pojawić się utrata masy ciała.
                                                W przebiegu kuru pojawia się zawsze ataksja móżdżkowa, która stopniowo
                                                postępuje, doprowadzając do śmierci. W przeciwieństwie do innych encefalopatii
                                                wywoływanych przez priony, w jej przebiegu prawie nigdy nie występuje
                                                otępienie, a o ile się pojawia to dopiero w fazie terminalnej. Ataksji
                                                towarzyszą drżenie, ruchy mimowolne (o typie ruchów pląsawiczych lub
                                                atetotycznych), nietrzymanie kału i moczu. Pojawiają się prymitywne odruchy,
                                                np. ssania, gryzienia, chwytania. Charakterystyczne są zmiany nastrojów: od
                                                depresji do euforii, a także przymusowy płacz bądź śmiech (stąd dziennikarskie
                                                określenie choroby, śmiejąca się śmierć)".
                                                Tyle encyklopedia, niestety nie jest to cała prawda. Pod koniec lat 80-tych
                                                ubiegłego wieku polsko-rosyjska wyprawa ze statku "Dar Darczyńców" zawlekła
                                                chorobę do południowo-wschodniej Europy (najprawdopodobniej chodziło o kontakt
                                                z plemieniem Ti-Tuo-Ti). Co jeszcze ciekawsze prion zmutował punktowo i
                                                nieoczekiwanie dla obserwatorów na czoło objawów wysunęły się: konieczność
                                                stawiania pomników, zakładania partii politycznych, cytowania Konfucjusza,
                                                kłótnie o budynki użyteczności publicznej oraz nieprawdopodobne wręcz zaleganie
                                                afektu.....




                                                  • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 02.04.07, 22:45
                                                    Freud, Jung, Adler, Frankl, Bergson, cóż ich teorie mocno trącą anachronizmem.
                                                    Obaliłem je już dawno ale jakoś nikt nie chciał (i nadal nie chce) słuchać lub
                                                    czytać.
                                                    Dzięki wątkowi, który miałem zaszczyt powołać (z inspiracji Tika -Taka)
                                                    wybitni naukowcy, sekowani przez naukowy plankton, ignorantów i zwykłych
                                                    karierowiczów, mają tu możliwość publikacji swoich odkryć, teorii itp. Wysoce
                                                    sobie cenię mozliwość kontaktu z przedsatwicielami nauki alternatywnej, łamiącej
                                                    względność fikcyjnych praw, walczących autarkią oficjalnych quasi-badaczy i
                                                    Quasimodo. W zaciszach pracowni i laboratoriów odkrywamy nie tyle nowe, co
                                                    istniejące prawidła, burzące dotychczasowe osiągnięcia pseudonaukowców,
                                                    tworzących fikcję a nawet hiperfikcję, no bo jak można twierdzić, że krantosy są
                                                    wyreinkarnowanym kwantum kreozelitów, czy bzdury w rodzaju : terpostaza jest
                                                    eliminatorem medotyksyny! A tak twierdzi, szkodzący nauce, nie tylko polskiej,
                                                    modny ostatnio, prof. Stanisław Materiał z Uniwersytetu Mleczarstwa i
                                                    Zarządzania w Oscypkowie. Pan Materiał jest obrzydliwym dywersantem naukowym a
                                                    oto dowód: nie dalej jak trzy lata temu, po kilkuletnich badań udało mi się
                                                    odkryć zupełnie nowe źródło pozyskiwania wosku pszczelego. Powiedziałem o tym
                                                    Materiałowi, bo miałem do niego zaufanie z czasów kiedy prowadziliśmy wspólne
                                                    badanie nad wpływem rogów krowich, na róg ul.ul. Smolki i Dworskiego. Po krótce
                                                    zreferuja owo odkrycie: otóż wosk pszczeli pozyskiwano z uli pszczelich ale
                                                    ciągle narzekano, ze jest go zbyt mało a gospodarka a szczególnie przemysł
                                                    gromniczny potrzebował go więcej i więcej. Ponadto ludność wiejska zamieszkujacą
                                                    rejony burzowe, narzekała iż prafinowe podróbki gromnic, nie odganiają burz tak
                                                    skutecznie, jak woskowe. To pchnęło mnie do poważnego zajęcia się woskologią. Po
                                                    kilku latach wyczerpujących badań stwierdziłem, że zapalona świeca topi się i
                                                    podczas topienia kapie z niej wosk! Najczystszy wosk! Z każdej swiecy
                                                    uzyskiwałem niemal tyle samo wosku ile ważyła świeca przed wytopieniem (minus
                                                    waga knota). Niestety, pan Materiał wykorzystując swoje układy wśród
                                                    komunistycznej nomenklatury nasłał na mnie funkcjonariuszy wydz. XXXVI, słynnego
                                                    Wydziału d/s Wosku, którzy przystąpili do rozpowszechniania fałszywych
                                                    wiadomości, że nieprawdą jest jakoby wosk mozna uzyskać z woskowej świecy. Nie
                                                    mogąc znieść tych prześladowań zająłem sie odzyskiwaniem myszy z gumek do
                                                    mazania oraz vice versa.
                                                  • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 03.04.07, 02:28
                                                    Piję sobie właśnie Chateau Margaux Premiere Grand Cru Classe (ohyda!) i
                                                    zastanawiam się czy George Chapline miał rację czy też nie twierdząc, iż czarne
                                                    dziury nie istnieją, a obiekty za nie uważane są właściwie gwiazdami z ciemną
                                                    energią. Ujemne ciśnienie oraz jej wszechobecność nie są mi zupełnie do niczego
                                                    potrzebne. Czuję, że to raczej brak potwierdzenia istnienia grawitonów tak
                                                    rozczarował astrofizyków. Teraz jednak muszę poobserwować jety gluonów
                                                    antyniebieskich co potrwa kilka dni, niemniej wygląda obiecująco....
                                                    P.S.1) Tik - Tak, to nie było o Tobie!
                                                    P.S.2)Wesołych Świąt :-)
                                                  • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 10.04.07, 02:59


                                                    Obecność na niebie Drogi Mlecznej sugeruje, że gwiazdy składające się na naszą
                                                    Galaktykę tworzą układ wyraźnie spłaszczony. Budowę i mechanikę Galaktyki
                                                    wygodnie jest więc opisywać we współrzędnych galaktycznych, dla których
                                                    podstawą jest równik galaktyczny, czyli koło wielkie przebiegające przez
                                                    najgęściej wypełnione gwiazdami obszary Drogi Mlecznej. Zero długości
                                                    galaktycznej wyznacza centralny obiekt Galaktyki, radioźródło Sagittarius A*, o
                                                    współrzędnych c = 17h42m,5 i c=28o55' (na epokę 1950.0). Północny biegun
                                                    galaktyczny leży w Warkoczu Bereniki, a długość galaktyczna wzrasta w kierunku
                                                    przeciwnym do ruchu wskazówek zegara, gdyby Galaktykę oglądać od strony tego
                                                    bieguna. Każde współrzędne można przeliczyć na każde inne, rozwiązując
                                                    odpowiednie trójkąty sferyczne, analogiczne do trójkąta paralaktycznego.
                                                    Spokojnej nocy.
                                                  • cfaniaczka Re: Nowy,intrygujący,pasjonujący i trudny wątek 10.04.07, 15:42
                                                    Mówisz o podstawie tej figury jedynie, The International Astronomical Union
                                                    podała, że jest ona nietypową płaszczyźniano-przestrzenną formą paralektyczną
                                                    poruszającą się ze szczytową prędkością Vs = 0 m/s, nie podlegającą żadnym
                                                    współrzędnym galaktycznym ani ogólnym prawom astronomii.
                                                    Radzą go ignorować, jak czarne dziury www.space.com , czeka go degradacja
                                                    podobna do niedawnej Plutona.
                                                  • selbstverstandlich Re: Nowy,intrygujący,pasjonujący i trudny wątek 10.04.07, 16:27
                                                    Pluton może jeszcze powróci do spisu planet...
                                                    Francuski kosmolog Jean Pierre de la Cour uważa, że zaistniało tam zjawisko
                                                    fermentacji (Mikołaj Kopernik wstrzymał grawitację, by astronauci przebywający
                                                    właśnie w kosmosie z Łajką, mogli wyrzucić przez okno rakiety niedojedzone
                                                    resztki psiej karmy - no i opadły one na planetę zwaną Plutonem). Potem
                                                    niedożywione mikroby z całego kosmosu spotkały się w miejscu wielkiej wyżerki
                                                    i rozpoczęły ucztowanie. Starczyło im na milion lat świetlnych. Niestety, będąc
                                                    w transie jedzenia, nie zauważyły, że wgryzają się w Pluton - żarły dalej
                                                    (czasownik - jeść - dałby temu wszystkiemu za łagodny wydźwięk). Przejadły się
                                                    i nastąpiła eksplozja - z Plutonem się pożegnaliśmy.
                                                  • jobrave Re: Nowy,intrygujący,pasjonujący i trudny wątek 11.04.07, 00:20
                                                    Radziłbym potraktować jednak poważnie wizję św. Jana,którą przedstawił był w
                                                    "Apokalipsie". Zamieszkiwana przez nas planeta jest potężnym rezerwuarem psiej
                                                    karmy - wystarczy powiedzieć, że u mnie w domu znajduje się obecnie 15.
                                                    kilogramowy worek "Friskies", ze nie wspomnę o podobnej ilości kociej "Kit- kat".
                                                    Drobnoustroje międzygalaktyczne (ehilochloris inetergalatcticius) , o których
                                                    wspomniał Selbstverstandlich, nie poprzestały na zagładzie Plutona - one
                                                    nieuchronnie zmierzają ku nam i zaręczam, że nie skończy się, to dobrze. Tzn.
                                                    nieskończyłoby się, gdybym nie wyhodował wirusów, które zamierzam wysłać w
                                                    mikroskopijnych rakietach na spotkanie żarłocznym bakteriom. Samo otrzymywanie
                                                    wirusów jest dziecinnie proste - powstają na skutek działania soku malinowego na
                                                    oponę samochodową, zawarty w ich DNA neutraliztor malinozowy, przekazywany przez
                                                    ostry szpic rakiety bedący jednocześnie mikroskopijną strzykawką. Malinoza
                                                    wstrzyknięta bakterii uszkadza DNA prostując spiralę powodując tym samym
                                                    spiraliozę odbierająca apetyt bakteriom. A nazwa planety Pluton pochodzi od psa
                                                    Pluto.
                                                  • hermenegildo Re: Nowy,intrygujący,pasjonujący i trudny wątek 11.04.07, 03:42
                                                    Ogólna Teoria Względności przewiduje istnienie we wnętrzu czarnej dziury
                                                    osobliwości. Jest to miejsce gdzie krzywizna czasoprzestrzeni staje się
                                                    nieskończona, a oddziaływanie grawitacyjne staje się nieskończenie silne (Roger
                                                    Penrose oraz Hawking). Znane są ścisłe dowody matematyczne mówiące o tym, nie
                                                    da się wyeliminować osobliwości z rozwiązań teorii w obecnym jej kształcie, w
                                                    szczególności jej istnienie jest niezależne od definicji układu odniesienia
                                                    używanego do opisu czarnej dziury. Przypuszcza się, że poszukiwana od lat
                                                    kwantowa teoria grawitacji rozwiąże ten problem. Warto nadmienić, że horyzont
                                                    zdarzeń nie jest żadną osobliwością i przejście przez ową barierę nie jest
                                                    związane z jakimikolwiek szczególnymi zjawiskami fizycznymi. Rozwiązanie
                                                    Schwarzschilda co prawda posiada nieciągłość na granicy horyzontu, jest ona
                                                    jednak usuwalna przez odpowiedni wybór układu odniesienia. Współczesna nauka
                                                    nie potrafi opisać zjawisk fizycznych zachodzących w osobliwości.
                                                    Ścisłe wyjaśnienie procesu parowania czarnych dziur polega na analizie
                                                    własności pól kwantowych w przestrzeni zakrzywionej, przy czym nie da się w
                                                    żaden sposób określić miejsca zachodzenia zjawiska parowania (powierzchnia
                                                    horyzontu zdarzeń, powierzchnia czarnej dziury itp.). Analiza procesu
                                                    wykorzystuje subtelne własności próżni kwantowej, rozkład modów normalnych pól
                                                    próżniowych oraz transformację Bogoliubowa. Jest to efekt globalny, w którym po
                                                    prostu bilans energetyczny czarnej dziury zmniejsza się kosztem otaczającej ją
                                                    przestrzeni. W szczególności nie jest prawdą, jakoby za zjawisko parowania
                                                    czarnych dziur odpowiadało tunelowanie fotonów przez horyzont zdarzeń, a także
                                                    opis lokalny tego procesu (w konkretnym miejscu przestrzeni). Są to wszystko
                                                    uproszczenia, mające służyć przedstawieniu publicznie owego procesu, nie zaś
                                                    jego wyjaśnieniu.
                                                    Dobranoc Państwu:-)